TRIM25 Antibody
24571-100ul 100ul
EUR 390
TRIM25 antibody
70R-20982 50 ul
EUR 435
Description: Rabbit polyclonal TRIM25 antibody
TRIM25 Antibody
43160-100ul 100ul
EUR 252
TRIM25 Antibody
1-CSB-PA054075
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50
TRIM25 Antibody
1-CSB-PA060115
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
TRIM25 Antibody
1-CSB-PA617909LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
TRIM25 Antibody
CSB-PA997812-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TRIM25 Antibody
CSB-PA997812-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TRIM25 Antibody
1-CSB-PA172995
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150
TRIM25 Antibody
1-CSB-PA024461GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
TRIM25 siRNA
20-abx938029
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRIM25 siRNA
20-abx938030
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TRIM25
YF-PA15423 50 ug
EUR 363
Description: Mouse polyclonal to TRIM25
anti-TRIM25
YF-PA15424 100 ul
EUR 403
Description: Rabbit polyclonal to TRIM25
anti-TRIM25
YF-PA15425 100 ug
EUR 403
Description: Rabbit polyclonal to TRIM25
anti-TRIM25
YF-PA24996 50 ul
EUR 334
Description: Mouse polyclonal to TRIM25
E3 Ubiquitin/ISG15 Ligase TRIM25 (TRIM25) Antibody
abx224319-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
TRIM25 Rabbit pAb
A12938-100ul 100 ul
EUR 308
TRIM25 Rabbit pAb
A12938-200ul 200 ul
EUR 459
TRIM25 Rabbit pAb
A12938-20ul 20 ul
EUR 183
TRIM25 Rabbit pAb
A12938-50ul 50 ul
EUR 223
TRIM25 Blocking Peptide
20-abx061223
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TRIM25 Conjugated Antibody
C43160 100ul
EUR 397
Polyclonal TRIM25 Antibody
APR06458G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 . This antibody is tested and proven to work in the following applications:
Polyclonal TRIM25 Antibody
APR06459G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 . This antibody is tested and proven to work in the following applications:
TRIM25 Antibody (HRP)
20-abx315016
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRIM25 Antibody (FITC)
20-abx315017
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRIM25 Antibody (Biotin)
20-abx315018
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRIM25 cloning plasmid
CSB-CL617909HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggcagagctgtgccccctggccgaggagctgtcgtgctccatctgcctggagcccttcaaggagccggtcaccactccgtgcggccacaacttctgcgggtcgtgcctgaatgagacgtgggcagtccagggctcgccatacctgtgcccgcagtgccgcgccgtctaccagg
  • Show more
Description: A cloning plasmid for the TRIM25 gene.
TRIM25 Rabbit mAb
A4347-100ul 100 ul
EUR 410
TRIM25 Rabbit mAb
A4347-200ul 200 ul
EUR 571
TRIM25 Rabbit mAb
A4347-20ul 20 ul
EUR 221
TRIM25 Rabbit mAb
A4347-50ul 50 ul
EUR 287
anti- TRIM25 antibody
FNab08976 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IF: 1:20-1:200
  • Immunogen: tripartite motif-containing 25
  • Uniprot ID: Q14258
  • Gene ID: 7706
  • Research Area: Epigenetics, Immunology, Metabolism
Description: Antibody raised against TRIM25
Anti-TRIM25 antibody
PAab08976 100 ug
EUR 412
pCAGGS-HA-TRIM25
PVT14013 2 ug
EUR 599
Anti-TRIM25 antibody
STJ11100763 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene.
Anti-TRIM25 antibody
STJ114804 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene.
Anti-TRIM25 (5C3)
YF-MA11023 100 ug
EUR 363
Description: Mouse monoclonal to TRIM25
Anti-TRIM25 (2B12)
YF-MA16180 100 ug
EUR 363
Description: Mouse monoclonal to TRIM25
Anti-TRIM25 (5F12)
YF-MA16181 100 ug
EUR 363
Description: Mouse monoclonal to TRIM25
Mouse E3 ubiquitin/ISG15 ligase TRIM25, Trim25 ELISA KIT
ELI-29036m 96 Tests
EUR 865
Human E3 ubiquitin/ISG15 ligase TRIM25, TRIM25 ELISA KIT
ELI-40165h 96 Tests
EUR 824
TRIM25 Antibody, HRP conjugated
1-CSB-PA617909LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TRIM25 Antibody, FITC conjugated
1-CSB-PA617909LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TRIM25 Antibody, Biotin conjugated
1-CSB-PA617909LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal TRIM25 Antibody (Center)
APR04146G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 (Center). This antibody is tested and proven to work in the following applications:
TRIM25 ELISA KIT|Human
EF003821 96 Tests
EUR 689
Human TRIM25 shRNA Plasmid
20-abx955224
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TRIM25 shRNA Plasmid
20-abx981073
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-TRIM25 Monoclonal Antibody
M03232 100ug
EUR 397
Description: Rabbit Monoclonal TRIM25 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
TRIM25 Recombinant Protein (Rat)
RP234665 100 ug Ask for price
pECMV-3-FLAG-TRIM25
PVT12769 2 ug
EUR 703
TRIM25 Recombinant Protein (Human)
RP032893 100 ug Ask for price
TRIM25 Recombinant Protein (Mouse)
RP181088 100 ug Ask for price
Polyclonal TRIM25 Antibody (C-Terminus)
APR02517G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 (C-Terminus). This antibody is tested and proven to work in the following applications:
[KO Validated] TRIM25 Rabbit pAb
A19887-100ul 100 ul
EUR 410
[KO Validated] TRIM25 Rabbit pAb
A19887-200ul 200 ul
EUR 571
[KO Validated] TRIM25 Rabbit pAb
A19887-20ul 20 ul
EUR 221
[KO Validated] TRIM25 Rabbit pAb
A19887-50ul 50 ul
EUR 287
Trim25 ORF Vector (Rat) (pORF)
ORF078223 1.0 ug DNA
EUR 506
TRIM25 ORF Vector (Human) (pORF)
ORF010965 1.0 ug DNA
EUR 95
Trim25 ORF Vector (Mouse) (pORF)
ORF060364 1.0 ug DNA
EUR 506
Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx004556
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx210308
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif-Containing 25 (TRIM25) Antibody
20-abx116274
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx133641
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
abx029113-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
abx029113-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
abx238976-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx339143
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
abx331231-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx324422
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
abx224437-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx302574
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.