ST6GALNAC2 siRNA
20-abx935332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST6GALNAC2 siRNA
20-abx935333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST6GALNAC2 Antibody
1-CSB-PA883452LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
anti-ST6GALNAC2
YF-PA17094 50 ug
EUR 363
Description: Mouse polyclonal to ST6GALNAC2
anti-ST6GALNAC2
YF-PA25627 50 ul
EUR 334
Description: Mouse polyclonal to ST6GALNAC2
ST6GALNAC2 Antibody (HRP)
20-abx311729
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST6GALNAC2 Antibody (FITC)
20-abx311730
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST6GALNAC2 Antibody (Biotin)
20-abx311731
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST6GALNAC2 Rabbit pAb
A17618-100ul 100 ul
EUR 308
ST6GALNAC2 Rabbit pAb
A17618-200ul 200 ul
EUR 459
ST6GALNAC2 Rabbit pAb
A17618-20ul 20 ul
EUR 183
ST6GALNAC2 Rabbit pAb
A17618-50ul 50 ul
EUR 223
ST6GALNAC2 Polyclonal Antibody
A67786 100 µg
EUR 570.55
Description: Ask the seller for details
ST6GALNAC2 Blocking Peptide
33R-9714 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC2 antibody, catalog no. 70R-7453
ST6GALNAC2 Polyclonal Antibody
30097-100ul 100ul
EUR 252
ST6GALNAC2 Polyclonal Antibody
30097-50ul 50ul
EUR 187
ST6GALNAC2 cloning plasmid
CSB-CL883452HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atggggctcccgcgcgggtcgttcttctggctgctgctcctgctcacggctgcctgctcggggctcctctttgccctgtacttctcggcggtgcagcggtacccggggccagcggccggagccagggacaccacatcatttgaagcattctttcaatccaaggcatcgaattctt
  • Show more
Description: A cloning plasmid for the ST6GALNAC2 gene.
Anti-ST6GALNAC2 antibody
STJ119680 100 µl
EUR 277
Description: ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]
ST6GALNAC2 Polyclonal Conjugated Antibody
C30097 100ul
EUR 397
Mouse St6galnac2 ELISA KIT
ELI-36078m 96 Tests
EUR 865
Chicken ST6GALNAC2 ELISA KIT
ELI-29702c 96 Tests
EUR 928
Human ST6GALNAC2 ELISA KIT
ELI-29818h 96 Tests
EUR 824
Human ST6GALNAC2 shRNA Plasmid
20-abx957223
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ST6GALNAC2 shRNA Plasmid
20-abx972695
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST6GALNAC2 Antibody, HRP conjugated
1-CSB-PA883452LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST6GALNAC2 Antibody, FITC conjugated
1-CSB-PA883452LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST6GALNAC2 Antibody, Biotin conjugated
1-CSB-PA883452LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ST6GALNAC2 Recombinant Protein (Human)
RP030244 100 ug Ask for price
ST6GALNAC2 Recombinant Protein (Rat)
RP231263 100 ug Ask for price
ST6GALNAC2 Recombinant Protein (Mouse)
RP175793 100 ug Ask for price
Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.
Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-1mg 1mg
EUR 1877
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.
Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-500ug 500ug
EUR 1328
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.
Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.
ST6GALNAC2 Polyclonal Antibody, HRP Conjugated
A67787 100 µg
EUR 570.55
Description: The best epigenetics products
ST6GALNAC2 Polyclonal Antibody, FITC Conjugated
A67788 100 µg
EUR 570.55
Description: kits suitable for this type of research
ST6GALNAC2 Polyclonal Antibody, Biotin Conjugated
A67789 100 µg
EUR 570.55
Description: fast delivery possible
St6galnac2 ORF Vector (Mouse) (pORF)
ORF058599 1.0 ug DNA
EUR 506
ST6GALNAC2 ORF Vector (Human) (pORF)
ORF010082 1.0 ug DNA
EUR 95
St6galnac2 ORF Vector (Rat) (pORF)
ORF077089 1.0 ug DNA
EUR 506
ST6GALNAC2 sgRNA CRISPR Lentivector set (Human)
K2295201 3 x 1.0 ug
EUR 339
St6galnac2 sgRNA CRISPR Lentivector set (Mouse)
K4646101 3 x 1.0 ug
EUR 339
St6galnac2 sgRNA CRISPR Lentivector set (Rat)
K7314901 3 x 1.0 ug
EUR 339
ST6GALNAC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2295202 1.0 ug DNA
EUR 154
ST6GALNAC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2295203 1.0 ug DNA
EUR 154
ST6GALNAC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2295204 1.0 ug DNA
EUR 154
St6galnac2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4646102 1.0 ug DNA
EUR 154
St6galnac2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4646103 1.0 ug DNA
EUR 154
St6galnac2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4646104 1.0 ug DNA
EUR 154
St6galnac2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7314902 1.0 ug DNA
EUR 154
St6galnac2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7314903 1.0 ug DNA
EUR 154
St6galnac2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7314904 1.0 ug DNA
EUR 154
ST6GALNAC2 Protein Vector (Human) (pPB-C-His)
PV040325 500 ng
EUR 329
ST6GALNAC2 Protein Vector (Human) (pPB-N-His)
PV040326 500 ng
EUR 329
ST6GALNAC2 Protein Vector (Human) (pPM-C-HA)
PV040327 500 ng
EUR 329
ST6GALNAC2 Protein Vector (Human) (pPM-C-His)
PV040328 500 ng
EUR 329
ST6GALNAC2 Protein Vector (Rat) (pPB-C-His)
PV308354 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Rat) (pPB-N-His)
PV308355 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Rat) (pPM-C-HA)
PV308356 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Rat) (pPM-C-His)
PV308357 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Mouse) (pPB-C-His)
PV234394 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Mouse) (pPB-N-His)
PV234395 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Mouse) (pPM-C-HA)
PV234396 500 ng
EUR 603
ST6GALNAC2 Protein Vector (Mouse) (pPM-C-His)
PV234397 500 ng
EUR 603
St6galnac2 3'UTR GFP Stable Cell Line
TU169778 1.0 ml Ask for price
St6galnac2 3'UTR Luciferase Stable Cell Line
TU119778 1.0 ml Ask for price
ST6GALNAC2 3'UTR GFP Stable Cell Line
TU074712 1.0 ml
EUR 1394
ST6GALNAC2 3'UTR Luciferase Stable Cell Line
TU024712 1.0 ml
EUR 1394
St6galnac2 3'UTR Luciferase Stable Cell Line
TU221247 1.0 ml Ask for price
St6galnac2 3'UTR GFP Stable Cell Line
TU271247 1.0 ml Ask for price
Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
ST6GALNAC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV632659 1.0 ug DNA
EUR 682
ST6GALNAC2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV632663 1.0 ug DNA
EUR 682
ST6GALNAC2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV632664 1.0 ug DNA
EUR 682
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 2 (ST6GALNAC2) Antibody
abx145703-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 2 (ST6GALNAC2) Antibody
20-abx311728
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST6GALNAC2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2295205 3 x 1.0 ug
EUR 376
St6galnac2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4646105 3 x 1.0 ug
EUR 376
St6galnac2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7314905 3 x 1.0 ug
EUR 376
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) ELISA kit
E06A1992-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) ELISA kit
E06A1992-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) ELISA kit
E06A1992-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.