Beopenlab

ST6GALNAC2 siRNA
20-abx935332	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ST6GALNAC2 siRNA
20-abx935333	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ST6GALNAC2 Antibody
1-CSB-PA883452LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

anti-ST6GALNAC2
YF-PA17094	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ST6GALNAC2

anti-ST6GALNAC2
YF-PA25627	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to ST6GALNAC2

ST6GALNAC2 Antibody (HRP)
20-abx311729	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ST6GALNAC2 Antibody (FITC)
20-abx311730	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ST6GALNAC2 Antibody (Biotin)
20-abx311731	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ST6GALNAC2 Rabbit pAb
A17618-100ul	Abclonal	100 ul	EUR 308

ST6GALNAC2 Rabbit pAb
A17618-200ul	Abclonal	200 ul	EUR 459

ST6GALNAC2 Rabbit pAb
A17618-20ul	Abclonal	20 ul	EUR 183

ST6GALNAC2 Rabbit pAb
A17618-50ul	Abclonal	50 ul	EUR 223

ST6GALNAC2 Polyclonal Antibody
A67786	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ST6GALNAC2 Blocking Peptide
33R-9714	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC2 antibody, catalog no. 70R-7453

ST6GALNAC2 Polyclonal Antibody
30097-100ul	SAB	100ul	EUR 252

ST6GALNAC2 Polyclonal Antibody
30097-50ul	SAB	50ul	EUR 187

ST6GALNAC2 cloning plasmid
CSB-CL883452HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1125 Sequence: atggggctcccgcgcgggtcgttcttctggctgctgctcctgctcacggctgcctgctcggggctcctctttgccctgtacttctcggcggtgcagcggtacccggggccagcggccggagccagggacaccacatcatttgaagcattctttcaatccaaggcatcgaattctt Show more
Description: A cloning plasmid for the ST6GALNAC2 gene.

Anti-ST6GALNAC2 antibody
STJ119680	St John's Laboratory	100 µl	EUR 277
Description: ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]

ST6GALNAC2 Polyclonal Conjugated Antibody
C30097	SAB	100ul	EUR 397

Mouse St6galnac2 ELISA KIT
ELI-36078m	Lifescience Market	96 Tests	EUR 865

Chicken ST6GALNAC2 ELISA KIT
ELI-29702c	Lifescience Market	96 Tests	EUR 928

Human ST6GALNAC2 ELISA KIT
ELI-29818h	Lifescience Market	96 Tests	EUR 824

Human ST6GALNAC2 shRNA Plasmid
20-abx957223	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ST6GALNAC2 shRNA Plasmid
20-abx972695	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ST6GALNAC2 Antibody, HRP conjugated
1-CSB-PA883452LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ST6GALNAC2 Antibody, FITC conjugated
1-CSB-PA883452LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ST6GALNAC2 Antibody, Biotin conjugated
1-CSB-PA883452LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC2. Recognizes ST6GALNAC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ST6GALNAC2 Recombinant Protein (Human)
RP030244	ABM	100 ug	Ask for price

ST6GALNAC2 Recombinant Protein (Rat)
RP231263	ABM	100 ug	Ask for price

ST6GALNAC2 Recombinant Protein (Mouse)
RP175793	ABM	100 ug	Ask for price

Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.

Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-1mg	Novoprotein	1mg	EUR 1877
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.

Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-500ug	Novoprotein	500ug	EUR 1328
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.

Recombinant Mouse ST6GALNAC2 (C-6His)
CB51-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of 50mMTris,150mMNaCl,pH7.5.

ST6GALNAC2 Polyclonal Antibody, HRP Conjugated
A67787	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ST6GALNAC2 Polyclonal Antibody, FITC Conjugated
A67788	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ST6GALNAC2 Polyclonal Antibody, Biotin Conjugated
A67789	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

St6galnac2 ORF Vector (Mouse) (pORF)
ORF058599	ABM	1.0 ug DNA	EUR 506

ST6GALNAC2 ORF Vector (Human) (pORF)
ORF010082	ABM	1.0 ug DNA	EUR 95

St6galnac2 ORF Vector (Rat) (pORF)
ORF077089	ABM	1.0 ug DNA	EUR 506

ST6GALNAC2 sgRNA CRISPR Lentivector set (Human)
K2295201	ABM	3 x 1.0 ug	EUR 339

St6galnac2 sgRNA CRISPR Lentivector set (Mouse)
K4646101	ABM	3 x 1.0 ug	EUR 339

St6galnac2 sgRNA CRISPR Lentivector set (Rat)
K7314901	ABM	3 x 1.0 ug	EUR 339

ST6GALNAC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2295202	ABM	1.0 ug DNA	EUR 154

ST6GALNAC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2295203	ABM	1.0 ug DNA	EUR 154

ST6GALNAC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2295204	ABM	1.0 ug DNA	EUR 154

St6galnac2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4646102	ABM	1.0 ug DNA	EUR 154

St6galnac2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4646103	ABM	1.0 ug DNA	EUR 154

St6galnac2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4646104	ABM	1.0 ug DNA	EUR 154

St6galnac2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7314902	ABM	1.0 ug DNA	EUR 154

St6galnac2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7314903	ABM	1.0 ug DNA	EUR 154

St6galnac2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7314904	ABM	1.0 ug DNA	EUR 154

ST6GALNAC2 Protein Vector (Human) (pPB-C-His)
PV040325	ABM	500 ng	EUR 329

ST6GALNAC2 Protein Vector (Human) (pPB-N-His)
PV040326	ABM	500 ng	EUR 329

ST6GALNAC2 Protein Vector (Human) (pPM-C-HA)
PV040327	ABM	500 ng	EUR 329

ST6GALNAC2 Protein Vector (Human) (pPM-C-His)
PV040328	ABM	500 ng	EUR 329

ST6GALNAC2 Protein Vector (Rat) (pPB-C-His)
PV308354	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Rat) (pPB-N-His)
PV308355	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Rat) (pPM-C-HA)
PV308356	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Rat) (pPM-C-His)
PV308357	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Mouse) (pPB-C-His)
PV234394	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Mouse) (pPB-N-His)
PV234395	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Mouse) (pPM-C-HA)
PV234396	ABM	500 ng	EUR 603

ST6GALNAC2 Protein Vector (Mouse) (pPM-C-His)
PV234397	ABM	500 ng	EUR 603

St6galnac2 3'UTR GFP Stable Cell Line
TU169778	ABM	1.0 ml	Ask for price

St6galnac2 3'UTR Luciferase Stable Cell Line
TU119778	ABM	1.0 ml	Ask for price

ST6GALNAC2 3'UTR GFP Stable Cell Line
TU074712	ABM	1.0 ml	EUR 1394

ST6GALNAC2 3'UTR Luciferase Stable Cell Line
TU024712	ABM	1.0 ml	EUR 1394

St6galnac2 3'UTR Luciferase Stable Cell Line
TU221247	ABM	1.0 ml	Ask for price

St6galnac2 3'UTR GFP Stable Cell Line
TU271247	ABM	1.0 ml	Ask for price

Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human ST6 Sialyltransferase 2/ST6GalNAc2 (C-6His)
C667-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

ST6GALNAC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV632659	ABM	1.0 ug DNA	EUR 682

ST6GALNAC2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV632663	ABM	1.0 ug DNA	EUR 682

ST6GALNAC2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV632664	ABM	1.0 ug DNA	EUR 682

Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 2 (ST6GALNAC2) Antibody
abx145703-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 2 (ST6GALNAC2) Antibody
20-abx311728	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ST6GALNAC2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2295205	ABM	3 x 1.0 ug	EUR 376

St6galnac2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4646105	ABM	3 x 1.0 ug	EUR 376

St6galnac2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7314905	ABM	3 x 1.0 ug	EUR 376

Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) ELISA kit
E06A1992-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) ELISA kit
E06A1992-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) ELISA kit
E06A1992-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 2(ST6GALNAC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.