Beopenlab

RPL8 antibody
70R-19990	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL8 antibody

RPL8 antibody
70R-1426	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RPL8 antibody raised against the C terminal of RPL8

RPL8 antibody
70R-1429	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RPL8 antibody raised against the C terminal of RPL8

RPL8 antibody
70R-15150	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL8 antibody

RPL8 Antibody
43561-100ul	SAB	100ul	EUR 252

RPL8 Antibody
1-CSB-PA00595A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPL8 Antibody
1-CSB-PA020323GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL8 siRNA
20-abx904676	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL8 siRNA
20-abx931997	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL8 siRNA
20-abx931998	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RPL8
YF-PA24600	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPL8

RPL8 Rabbit pAb
A10042-100ul	Abclonal	100 ul	EUR 308

RPL8 Rabbit pAb
A10042-200ul	Abclonal	200 ul	EUR 459

RPL8 Rabbit pAb
A10042-20ul	Abclonal	20 ul	EUR 183

RPL8 Rabbit pAb
A10042-50ul	Abclonal	50 ul	EUR 223

RPL8 Blocking Peptide
33R-2455	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL8 antibody, catalog no. 70R-1426

RPL8 Blocking Peptide
33R-4496	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL8 antibody, catalog no. 70R-1429

RPL8 antibody (HRP)
60R-1287	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL8 antibody (HRP)

RPL8 antibody (FITC)
60R-1288	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL8 antibody (FITC)

RPL8 antibody (biotin)
60R-1289	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL8 antibody (biotin)

RPL8 Conjugated Antibody
C43561	SAB	100ul	EUR 397

RPL8 cloning plasmid
CSB-CL020323HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 774 Sequence: atgggccgtgtgatccgtggacagaggaagggcgccgggtctgtgttccgcgcgcacgtgaagcaccgtaaaggcgctgcgcgcctgcgcgccgtggatttcgctgagcggcacggctacatcaagggcatcgtcaaggacatcatccacgacccgggccgcggcgcgcccctcgc Show more
Description: A cloning plasmid for the RPL8 gene.

RPL8 cloning plasmid
CSB-CL020323HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 774 Sequence: atgggccgtgtgatccgtggacagaggaagggcgccgggtctgtgttccgcgcgcacgtgaagcaccgtaaaggcgctgcgcgcctgcgcgccgtggatttcgctgagcggcacggctacatcaagggcatcgtcaaggacatcatccacgacccgggccgcggcgcgcccctcgc Show more
Description: A cloning plasmid for the RPL8 gene.

RPL8 Polyclonal Antibody
A52653	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

anti- RPL8 antibody
FNab07445	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L8 Uniprot ID: P62917 Gene ID: 6132 Research Area: Metabolism
Description: Antibody raised against RPL8

Anti-RPL8 antibody
PAab07445	Lifescience Market	100 ug	EUR 386

Anti-RPL8 antibody
STJ112082	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L2P family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein associates with the 5.8S rRNA, very likely participates in the binding of aminoacyl-tRNA, and is a constituent of the elongation factor 2-binding site at the ribosomal subunit interface. Alternatively spliced transcript variants encoding the same protein exist. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

RPL8 Antibody, HRP conjugated
1-CSB-PA00595B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL8 Antibody, FITC conjugated
1-CSB-PA00595C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL8 Antibody, Biotin conjugated
1-CSB-PA00595D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL8 protein (His tag)
80R-2186	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant Human RPL8 protein (His tag)

RPL8 ELISA KIT|Human
EF002603	Lifescience Market	96 Tests	EUR 689

Mouse RPL8 shRNA Plasmid
20-abx973805	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPL8 shRNA Plasmid
20-abx985291	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RPL8 shRNA Plasmid
20-abx954123	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL8 Recombinant Protein (Human)
RP027025	ABM	100 ug	Ask for price

RPL8 Recombinant Protein (Human)
RP027028	ABM	100 ug	Ask for price

RPL8 Recombinant Protein (Mouse)
RP169124	ABM	100 ug	Ask for price

RPL8 Recombinant Protein (Rat)
RP226727	ABM	100 ug	Ask for price

Ribosomal Protein L8 (RPL8) Antibody
abx028006-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody
abx028006-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody
20-abx115250	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody
20-abx135960	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody
abx237445-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein L8 (RPL8) Antibody
abx431857-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Ribosomal Protein L8 (RPL8) Protein
20-abx262501	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

RPL8 Polyclonal Antibody, HRP Conjugated
A52654	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPL8 Polyclonal Antibody, FITC Conjugated
A52655	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RPL8 Polyclonal Antibody, Biotin Conjugated
A52656	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Rpl8 ORF Vector (Rat) (pORF)
ORF075577	ABM	1.0 ug DNA	EUR 506

RPL8 ORF Vector (Human) (pORF)
ORF009009	ABM	1.0 ug DNA	EUR 95

RPL8 ORF Vector (Human) (pORF)
ORF009010	ABM	1.0 ug DNA	EUR 95

Rpl8 ORF Vector (Mouse) (pORF)
ORF056376	ABM	1.0 ug DNA	EUR 506

Human 60S ribosomal protein L8 (RPL8)
1-CSB-RP005954h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L8(RPL8),partial expressed in E.coli

Ribosomal Protein L8 (RPL8) Antibody Pair
abx117461-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

60S Ribosomal Protein L8 (RPL8) Antibody
20-abx109477	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rpl8 sgRNA CRISPR Lentivector set (Rat)
K6763701	ABM	3 x 1.0 ug	EUR 339

Rpl8 sgRNA CRISPR Lentivector set (Mouse)
K4406201	ABM	3 x 1.0 ug	EUR 339

RPL8 sgRNA CRISPR Lentivector set (Human)
K1894401	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein L8 (RPL8) ELISA Kit
abx382929-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rpl8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6763702	ABM	1.0 ug DNA	EUR 154

Rpl8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6763703	ABM	1.0 ug DNA	EUR 154

Rpl8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6763704	ABM	1.0 ug DNA	EUR 154

Rpl8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4406202	ABM	1.0 ug DNA	EUR 154

Rpl8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4406203	ABM	1.0 ug DNA	EUR 154

Rpl8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4406204	ABM	1.0 ug DNA	EUR 154

RPL8 sgRNA CRISPR Lentivector (Human) (Target 1)
K1894402	ABM	1.0 ug DNA	EUR 154

RPL8 sgRNA CRISPR Lentivector (Human) (Target 2)
K1894403	ABM	1.0 ug DNA	EUR 154

RPL8 sgRNA CRISPR Lentivector (Human) (Target 3)
K1894404	ABM	1.0 ug DNA	EUR 154

RPL8 Ribosomal Protein L8 Human Recombinant Protein
PROTP62917	BosterBio	Regular: 10ug	EUR 317
Description: RPL8 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 277 amino acids (1-257 a.a) and having a molecular mass of 30.2kDa.;RPL8 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL8 Protein Vector (Rat) (pPB-C-His)
PV302306	ABM	500 ng	EUR 603

RPL8 Protein Vector (Rat) (pPB-N-His)
PV302307	ABM	500 ng	EUR 603

RPL8 Protein Vector (Rat) (pPM-C-HA)
PV302308	ABM	500 ng	EUR 603

RPL8 Protein Vector (Rat) (pPM-C-His)
PV302309	ABM	500 ng	EUR 603

RPL8 Protein Vector (Mouse) (pPB-C-His)
PV225502	ABM	500 ng	EUR 603

RPL8 Protein Vector (Mouse) (pPB-N-His)
PV225503	ABM	500 ng	EUR 603

RPL8 Protein Vector (Mouse) (pPM-C-HA)
PV225504	ABM	500 ng	EUR 603

RPL8 Protein Vector (Mouse) (pPM-C-His)
PV225505	ABM	500 ng	EUR 603

RPL8 Protein Vector (Human) (pPB-C-His)
PV036033	ABM	500 ng	EUR 329

RPL8 Protein Vector (Human) (pPB-N-His)
PV036034	ABM	500 ng	EUR 329

RPL8 Protein Vector (Human) (pPM-C-HA)
PV036035	ABM	500 ng	EUR 329

RPL8 Protein Vector (Human) (pPM-C-His)
PV036036	ABM	500 ng	EUR 329

RPL8 Protein Vector (Human) (pPB-C-His)
PV036037	ABM	500 ng	EUR 329

RPL8 Protein Vector (Human) (pPB-N-His)
PV036038	ABM	500 ng	EUR 329

RPL8 Protein Vector (Human) (pPM-C-HA)
PV036039	ABM	500 ng	EUR 329