RPL8 antibody

70R-19990 50 ul
EUR 435
Description: Rabbit polyclonal RPL8 antibody

RPL8 antibody

70R-1426 100 ug
EUR 377
Description: Rabbit polyclonal RPL8 antibody raised against the C terminal of RPL8

RPL8 antibody

70R-1429 100 ug
EUR 377
Description: Rabbit polyclonal RPL8 antibody raised against the C terminal of RPL8

RPL8 antibody

70R-15150 100 ug
EUR 327
Description: Rabbit polyclonal RPL8 antibody

RPL8 Antibody

43561-100ul 100ul
EUR 252

RPL8 Antibody

1-CSB-PA00595A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPL8 Antibody

1-CSB-PA020323GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL8 siRNA

20-abx904676
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL8 siRNA

20-abx931997
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL8 siRNA

20-abx931998
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RPL8

YF-PA24600 50 ul
EUR 334
Description: Mouse polyclonal to RPL8

RPL8 Rabbit pAb

A10042-100ul 100 ul
EUR 308

RPL8 Rabbit pAb

A10042-200ul 200 ul
EUR 459

RPL8 Rabbit pAb

A10042-20ul 20 ul
EUR 183

RPL8 Rabbit pAb

A10042-50ul 50 ul
EUR 223

RPL8 Blocking Peptide

33R-2455 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL8 antibody, catalog no. 70R-1426

RPL8 Blocking Peptide

33R-4496 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL8 antibody, catalog no. 70R-1429

RPL8 antibody (HRP)

60R-1287 100 ug
EUR 327
Description: Rabbit polyclonal RPL8 antibody (HRP)

RPL8 antibody (FITC)

60R-1288 100 ug
EUR 327
Description: Rabbit polyclonal RPL8 antibody (FITC)

RPL8 antibody (biotin)

60R-1289 100 ug
EUR 327
Description: Rabbit polyclonal RPL8 antibody (biotin)

RPL8 Conjugated Antibody

C43561 100ul
EUR 397

RPL8 cloning plasmid

CSB-CL020323HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: atgggccgtgtgatccgtggacagaggaagggcgccgggtctgtgttccgcgcgcacgtgaagcaccgtaaaggcgctgcgcgcctgcgcgccgtggatttcgctgagcggcacggctacatcaagggcatcgtcaaggacatcatccacgacccgggccgcggcgcgcccctcgc
  • Show more
Description: A cloning plasmid for the RPL8 gene.

RPL8 cloning plasmid

CSB-CL020323HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: atgggccgtgtgatccgtggacagaggaagggcgccgggtctgtgttccgcgcgcacgtgaagcaccgtaaaggcgctgcgcgcctgcgcgccgtggatttcgctgagcggcacggctacatcaagggcatcgtcaaggacatcatccacgacccgggccgcggcgcgcccctcgc
  • Show more
Description: A cloning plasmid for the RPL8 gene.

RPL8 Polyclonal Antibody

A52653 100 µg
EUR 570.55
Description: reagents widely cited

anti- RPL8 antibody

FNab07445 100µg
EUR 548.75
  • Immunogen: ribosomal protein L8
  • Uniprot ID: P62917
  • Gene ID: 6132
  • Research Area: Metabolism
Description: Antibody raised against RPL8

Anti-RPL8 antibody

PAab07445 100 ug
EUR 386

Anti-RPL8 antibody

STJ112082 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L2P family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein associates with the 5.8S rRNA, very likely participates in the binding of aminoacyl-tRNA, and is a constituent of the elongation factor 2-binding site at the ribosomal subunit interface. Alternatively spliced transcript variants encoding the same protein exist. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

RPL8 Antibody, HRP conjugated

1-CSB-PA00595B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL8 Antibody, FITC conjugated

1-CSB-PA00595C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL8 Antibody, Biotin conjugated

1-CSB-PA00595D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL8. Recognizes RPL8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL8 protein (His tag)

80R-2186 50 ug
EUR 424
Description: Purified recombinant Human RPL8 protein (His tag)

RPL8 ELISA KIT|Human

EF002603 96 Tests
EUR 689

Mouse RPL8 shRNA Plasmid

20-abx973805
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL8 shRNA Plasmid

20-abx985291
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL8 shRNA Plasmid

20-abx954123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL8 Recombinant Protein (Human)

RP027025 100 ug Ask for price

RPL8 Recombinant Protein (Human)

RP027028 100 ug Ask for price

RPL8 Recombinant Protein (Mouse)

RP169124 100 ug Ask for price

RPL8 Recombinant Protein (Rat)

RP226727 100 ug Ask for price

Ribosomal Protein L8 (RPL8) Antibody

abx028006-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody

abx028006-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody

20-abx115250
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody

20-abx135960
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L8 (RPL8) Antibody

abx237445-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L8 (RPL8) Antibody

abx431857-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ribosomal Protein L8 (RPL8) Protein

20-abx262501
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RPL8 Polyclonal Antibody, HRP Conjugated

A52654 100 µg
EUR 570.55
Description: Ask the seller for details

RPL8 Polyclonal Antibody, FITC Conjugated

A52655 100 µg
EUR 570.55
Description: The best epigenetics products

RPL8 Polyclonal Antibody, Biotin Conjugated

A52656 100 µg
EUR 570.55
Description: kits suitable for this type of research

Rpl8 ORF Vector (Rat) (pORF)

ORF075577 1.0 ug DNA
EUR 506

RPL8 ORF Vector (Human) (pORF)

ORF009009 1.0 ug DNA
EUR 95

RPL8 ORF Vector (Human) (pORF)

ORF009010 1.0 ug DNA
EUR 95

Rpl8 ORF Vector (Mouse) (pORF)

ORF056376 1.0 ug DNA
EUR 506

Human 60S ribosomal protein L8 (RPL8)

1-CSB-RP005954h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L8(RPL8),partial expressed in E.coli

Ribosomal Protein L8 (RPL8) Antibody Pair

abx117461-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

60S Ribosomal Protein L8 (RPL8) Antibody

20-abx109477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl8 sgRNA CRISPR Lentivector set (Rat)

K6763701 3 x 1.0 ug
EUR 339

Rpl8 sgRNA CRISPR Lentivector set (Mouse)

K4406201 3 x 1.0 ug
EUR 339

RPL8 sgRNA CRISPR Lentivector set (Human)

K1894401 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L8 (RPL8) ELISA Kit

abx382929-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6763702 1.0 ug DNA
EUR 154

Rpl8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6763703 1.0 ug DNA
EUR 154

Rpl8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6763704 1.0 ug DNA
EUR 154

Rpl8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4406202 1.0 ug DNA
EUR 154

Rpl8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4406203 1.0 ug DNA
EUR 154

Rpl8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4406204 1.0 ug DNA
EUR 154

RPL8 sgRNA CRISPR Lentivector (Human) (Target 1)

K1894402 1.0 ug DNA
EUR 154

RPL8 sgRNA CRISPR Lentivector (Human) (Target 2)

K1894403 1.0 ug DNA
EUR 154

RPL8 sgRNA CRISPR Lentivector (Human) (Target 3)

K1894404 1.0 ug DNA
EUR 154

RPL8 Ribosomal Protein L8 Human Recombinant Protein

PROTP62917 Regular: 10ug
EUR 317
Description: RPL8 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 277 amino acids (1-257 a.a) and having a molecular mass of 30.2kDa.;RPL8 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL8 Protein Vector (Rat) (pPB-C-His)

PV302306 500 ng
EUR 603

RPL8 Protein Vector (Rat) (pPB-N-His)

PV302307 500 ng
EUR 603

RPL8 Protein Vector (Rat) (pPM-C-HA)

PV302308 500 ng
EUR 603

RPL8 Protein Vector (Rat) (pPM-C-His)

PV302309 500 ng
EUR 603

RPL8 Protein Vector (Mouse) (pPB-C-His)

PV225502 500 ng
EUR 603

RPL8 Protein Vector (Mouse) (pPB-N-His)

PV225503 500 ng
EUR 603

RPL8 Protein Vector (Mouse) (pPM-C-HA)

PV225504 500 ng
EUR 603

RPL8 Protein Vector (Mouse) (pPM-C-His)

PV225505 500 ng
EUR 603

RPL8 Protein Vector (Human) (pPB-C-His)

PV036033 500 ng
EUR 329

RPL8 Protein Vector (Human) (pPB-N-His)

PV036034 500 ng
EUR 329

RPL8 Protein Vector (Human) (pPM-C-HA)

PV036035 500 ng
EUR 329

RPL8 Protein Vector (Human) (pPM-C-His)

PV036036 500 ng
EUR 329

RPL8 Protein Vector (Human) (pPB-C-His)

PV036037 500 ng
EUR 329

RPL8 Protein Vector (Human) (pPB-N-His)

PV036038 500 ng
EUR 329

RPL8 Protein Vector (Human) (pPM-C-HA)

PV036039 500 ng
EUR 329