PHC1 siRNA

20-abx928417
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHC1 Antibody

33082-100ul 100ul
EUR 252

PHC1 Antibody

1-CSB-PA017891HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PHC1 Conjugated Antibody

C33082 100ul
EUR 397

PHC1 cloning plasmid

CSB-CL017891HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgccaggtacagtgcagtctggtcaggcccatttggcctcctcgccaccttcatcccaggctcctggtgcactgcaggagtgccctcccacattggcccctgggatgacccttgctcctgtgcaggggacagcacatgtggtaaagggtggggctaccacctcctcacctgttg
  • Show more
Description: A cloning plasmid for the PHC1 gene.

PHC1 Polyclonal Antibody

A-2731 100 µl
EUR 483.55
Description: kits suitable for this type of research

PHC1 Rabbit pAb

A5843-100ul 100 ul
EUR 308

PHC1 Rabbit pAb

A5843-200ul 200 ul
EUR 459

PHC1 Rabbit pAb

A5843-20ul 20 ul
EUR 183

PHC1 Rabbit pAb

A5843-50ul 50 ul
EUR 223

Anti-PHC1 antibody

STJ28406 100 µl
EUR 277
Description: This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein.

anti-EDR1 / PHC1

YF-PA11492 50 ug
EUR 363
Description: Mouse polyclonal to EDR1 / PHC1

anti-EDR1 / PHC1

YF-PA11493 100 ul
EUR 403
Description: Rabbit polyclonal to EDR1 / PHC1

anti-EDR1 / PHC1

YF-PA11494 100 ug
EUR 403
Description: Rabbit polyclonal to EDR1 / PHC1

Human PHC1 shRNA Plasmid

20-abx951330
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PHC1 shRNA Plasmid

20-abx970111
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PHC1 Antibody, HRP conjugated

1-CSB-PA017891HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PHC1 Antibody, FITC conjugated

1-CSB-PA017891HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PHC1 Antibody, Biotin conjugated

1-CSB-PA017891HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-EDR1 / PHC1 (3G1)

YF-MA12776 100 ug
EUR 363
Description: Mouse monoclonal to EDR1 / PHC1

Monoclonal PHC1 Antibody, Clone: 1F3F3

APR17840G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PHC1. The antibodies are raised in Mouse and are from clone 1F3F3. This antibody is applicable in WB, FC, E

Polyclonal PHC1 Antibody (N-Term)

APR17841G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHC1 (N-Term). This antibody is tested and proven to work in the following applications:

PHC1 ORF Vector (Human) (pORF)

ORF007761 1.0 ug DNA
EUR 95

Phc1 ORF Vector (Rat) (pORF)

ORF073428 1.0 ug DNA
EUR 506

Phc1 ORF Vector (Mouse) (pORF)

ORF053900 1.0 ug DNA
EUR 506

Phc1 ORF Vector (Mouse) (pORF)

ORF053901 1.0 ug DNA
EUR 506

Polyhomeotic-Like Protein 1 (PHC1) Antibody

20-abx141807
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody

20-abx004481
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody

abx015967-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody

20-abx312993
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHC1 sgRNA CRISPR Lentivector set (Human)

K1638101 3 x 1.0 ug
EUR 339

Phc1 sgRNA CRISPR Lentivector set (Mouse)

K3723601 3 x 1.0 ug
EUR 339

Phc1 sgRNA CRISPR Lentivector set (Rat)

K6670901 3 x 1.0 ug
EUR 339

Monoclonal PHC1 Antibody (monoclonal) (M05), Clone: 3G1

AMM07121G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PHC1 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 3G1. This antibody is applicable in WB, E

Polyhomeotic-Like Protein 1 (PHC1) Antibody (HRP)

20-abx312994
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody (FITC)

20-abx312995
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody (Biotin)

20-abx312996
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1638102 1.0 ug DNA
EUR 154

PHC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1638103 1.0 ug DNA
EUR 154

PHC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1638104 1.0 ug DNA
EUR 154

Phc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3723602 1.0 ug DNA
EUR 154

Phc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3723603 1.0 ug DNA
EUR 154

Phc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3723604 1.0 ug DNA
EUR 154

Phc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6670902 1.0 ug DNA
EUR 154

Phc1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6670903 1.0 ug DNA
EUR 154

Phc1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6670904 1.0 ug DNA
EUR 154

PHC1 Protein Vector (Human) (pPB-C-His)

PV031041 500 ng
EUR 329

PHC1 Protein Vector (Human) (pPB-N-His)

PV031042 500 ng
EUR 329

PHC1 Protein Vector (Human) (pPM-C-HA)

PV031043 500 ng
EUR 329

PHC1 Protein Vector (Human) (pPM-C-His)

PV031044 500 ng
EUR 329

PHC1 Protein Vector (Mouse) (pPB-C-His)

PV215598 500 ng
EUR 1065

PHC1 Protein Vector (Mouse) (pPB-N-His)

PV215599 500 ng
EUR 1065

PHC1 Protein Vector (Mouse) (pPM-C-HA)

PV215600 500 ng
EUR 1065

PHC1 Protein Vector (Mouse) (pPM-C-His)

PV215601 500 ng
EUR 1065

PHC1 Protein Vector (Mouse) (pPB-C-His)

PV215602 500 ng
EUR 1065