Human Prefoldin Subunit 1 (PFDN1) ELISA Kit

DLR-PFDN1-Hu-96T 96T
EUR 673
  • Should the Human Prefoldin Subunit 1 (PFDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prefoldin Subunit 1 (PFDN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prefoldin Subunit 1 (PFDN1) ELISA Kit

RD-PFDN1-Hu-48Tests 48 Tests
EUR 521

Human Prefoldin Subunit 1 (PFDN1) ELISA Kit

RD-PFDN1-Hu-96Tests 96 Tests
EUR 723

Human Prefoldin Subunit 1 (PFDN1) ELISA Kit

RDR-PFDN1-Hu-48Tests 48 Tests
EUR 544

Human Prefoldin Subunit 1 (PFDN1) ELISA Kit

RDR-PFDN1-Hu-96Tests 96 Tests
EUR 756

PFDN1 Antibody

AF0748 200ul
EUR 304
Description: PFDN1 Antibody detects endogenous levels of PFDN1.

PFDN1 Antibody

ABF0748 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PFDN1 antibody

70R-33731 100 ug
EUR 327
Description: Rabbit polyclonal PFDN1 antibody

PFDN1 Antibody

ABD3038 100 ug
EUR 438

PFDN1 Antibody

33606-100ul 100ul
EUR 252

PFDN1 Antibody

33606-50ul 50ul
EUR 187

PFDN1 antibody

70R-19224 50 ul
EUR 435
Description: Rabbit polyclonal PFDN1 antibody

PFDN1 antibody

70R-15453 100 ug
EUR 327
Description: Rabbit polyclonal PFDN1 antibody

PFDN1 Antibody

DF3038 200ul
EUR 304
Description: PFDN1 Antibody detects endogenous levels of total PFDN1.

PFDN1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PFDN1 Antibody

CSB-PA059337-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PFDN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PFDN1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PFDN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


YF-PA13726 50 ul
EUR 363
Description: Mouse polyclonal to PFDN1

PFDN1 Conjugated Antibody

C33606 100ul
EUR 397

PFDN1 Blocking Peptide

AF0748-BP 1mg
EUR 195

PFDN1 cloning plasmid

CSB-CL017812HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atggccgcccccgtggatctagagctgaagaaggccttcacagagcttcaagccaaagttattgacactcaacagaaggtgaagctcgcagacatacagattgaacagctaaacagaacgaaaaagcatgcacatcttacagatacagagatcatgactttggtagatgagactaa
  • Show more
Description: A cloning plasmid for the PFDN1 gene.

anti- PFDN1 antibody

FNab06334 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: prefoldin subunit 1
  • Uniprot ID: O60925
  • Gene ID: 5201
  • Research Area: Metabolism
Description: Antibody raised against PFDN1

PFDN1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PFDN1 Polyclonal Antibody

A51489 100 µg
EUR 570.55
Description: fast delivery possible

PFDN1 Rabbit pAb

A8681-100ul 100 ul
EUR 308

PFDN1 Rabbit pAb

A8681-200ul 200 ul
EUR 459

PFDN1 Rabbit pAb

A8681-20ul 20 ul
EUR 183

PFDN1 Rabbit pAb

A8681-50ul 50 ul
EUR 223

PFDN1 antibody (HRP)

60R-2173 100 ug
EUR 327
Description: Rabbit polyclonal PFDN1 antibody (HRP)

PFDN1 antibody (FITC)

60R-2174 100 ug
EUR 327
Description: Rabbit polyclonal PFDN1 antibody (FITC)

PFDN1 antibody (biotin)

60R-2175 100 ug
EUR 327
Description: Rabbit polyclonal PFDN1 antibody (biotin)

PFDN1 Blocking Peptide

DF3038-BP 1mg
EUR 195

Anti-PFDN1 antibody

PAab06334 100 ug
EUR 412

Anti-PFDN1 antibody

STJ113579 100 µl
EUR 277
Description: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.


abx595675-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.


EF001696 96 Tests
EUR 689

Human PFDN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PFDN1 protein (His tag)

80R-1531 10 ug
EUR 305
Description: Purified recombinant Human PFDN1 protein

PFDN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PFDN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PFDN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN1. Recognizes PFDN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PFDN1 Recombinant Protein (Human)

RP023158 100 ug Ask for price

PFDN1 Recombinant Protein (Rat)

RP220124 100 ug Ask for price

PFDN1 Recombinant Protein (Mouse)

RP161435 100 ug Ask for price

Polyclonal PFDN1 Antibody (aa1-50)

AMM07106G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PFDN1 (aa1-50). This antibody is tested and proven to work in the following applications:

PFDN1 Colorimetric Cell-Based ELISA

EKC1644 100ul
EUR 572

Prefoldin Subunit 1 (PFDN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prefoldin Subunit 1 (PFDN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prefoldin Subunit 1 (PFDN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prefoldin Subunit 1 (PFDN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prefoldin Subunit 1 (PFDN1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Prefoldin Subunit 1 (PFDN1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.