Beopenlab

EIF2S2 siRNA
20-abx915154	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2S2 antibody
70R-36848	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal EIF2S2 antibody

EIF2S2 antibody
70R-4904	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 antibody
70R-4905	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 Antibody
ABD4050	Lifescience Market	100 ug	EUR 438

EIF2S2 Antibody
33102-100ul	SAB	100ul	EUR 252

EIF2S2 antibody
70R-17044	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EIF2S2 antibody

EIF2S2 Antibody
DF4050	Affbiotech	200ul	EUR 304
Description: EIF2S2 Antibody detects endogenous levels of total EIF2S2.

EIF2S2 Antibody
1-CSB-PA007524GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

EIF2S2 Antibody
1-CSB-PA010574	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EIF2S2 Antibody
1-CSB-PA070174	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

pOTB7-EIF2S2
PVT18393	Lifescience Market	2 ug	EUR 231

EIF2S2 Conjugated Antibody
C33102	SAB	100ul	EUR 397

EIF2S2 cloning plasmid
CSB-CL007524HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1002 Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid
CSB-CL007524HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 645 Sequence: atgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgagga Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid
CSB-CL007524HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1002 Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag Show more
Description: A cloning plasmid for the EIF2S2 gene.

anti- EIF2S2 antibody
FNab02700	FN Test	100µg	EUR 548.75
Immunogen: eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Uniprot ID: P20042 Gene ID: 8894 Research Area: Metabolism
Description: Antibody raised against EIF2S2

EIF2S2 (pS67) Antibody
20-abx121086	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

EIF2S2 (pS2) Antibody
20-abx000391	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

EIF2S2 Rabbit pAb
A5894-100ul	Abclonal	100 ul	EUR 308

EIF2S2 Rabbit pAb
A5894-200ul	Abclonal	200 ul	EUR 459

EIF2S2 Rabbit pAb
A5894-20ul	Abclonal	20 ul	EUR 183

EIF2S2 Rabbit pAb
A5894-50ul	Abclonal	50 ul	EUR 223

EIF2S2 Rabbit pAb
A14498-100ul	Abclonal	100 ul	EUR 308

EIF2S2 Rabbit pAb
A14498-200ul	Abclonal	200 ul	EUR 459

EIF2S2 Rabbit pAb
A14498-20ul	Abclonal	20 ul	EUR 183

EIF2S2 Rabbit pAb
A14498-50ul	Abclonal	50 ul	EUR 223

EIF2S2 Blocking Peptide
33R-1911	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4904

EIF2S2 Blocking Peptide
33R-9251	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4905

EIF2S2 Blocking Peptide
DF4050-BP	Affbiotech	1mg	EUR 195

Anti-EIF2S2 antibody
PAab02700	Lifescience Market	100 ug	EUR 386

Anti-EIF2S2 Antibody
PA2157	BosterBio	100ug/vial	EUR 294

pCMV-SPORT6-EIF2S2
PVT18199	Lifescience Market	2 ug	EUR 231

pENTR223-EIF2S2 vector
PVT11718	Lifescience Market	2 ug	EUR 304

Anti-EIF2S2 antibody
STJ28167	St John's Laboratory	100 µl	EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 antibody
STJ116709	St John's Laboratory	100 µl	EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 (2F3)
YF-MA16593	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EIF2S2

Mouse EIF2S2 shRNA Plasmid
20-abx976031	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine EIF2S2 ELISA KIT
ELI-08424b	Lifescience Market	96 Tests	EUR 928

EIF2S2 ELISA KIT|Human
EF009336	Lifescience Market	96 Tests	EUR 689

Human EIF2S2 ELISA KIT
ELI-43377h	Lifescience Market	96 Tests	EUR 824

Mouse Eif2s2 ELISA KIT
ELI-48691m	Lifescience Market	96 Tests	EUR 865

EIF2S2 (pS67) Blocking Peptide
20-abx161086	Abbexa	EUR 314.00 EUR 509.00	1 mg 5 mg
Shipped within 5-10 working days.

Human EIF2S2 shRNA Plasmid
20-abx955879	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-EIF2S2 (Ser2) Antibody
CSB-PA790061-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EIF2S2 (Ser2) Antibody
CSB-PA790061-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EIF2S2 (Ab-67) Antibody
CSB-PA566738-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 (Ab-67) Antibody
CSB-PA566738-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 Recombinant Protein (Human)
RP010384	ABM	100 ug	Ask for price

EIF2S2 Recombinant Protein (Human)
RP010387	ABM	100 ug	Ask for price

EIF2S2 Recombinant Protein (Human)
RP010390	ABM	100 ug	Ask for price

pECMV-3-FLAG-EIF2S2
PVT13567	Lifescience Market	2 ug	EUR 599

EIF2S2 Recombinant Protein (Rat)
RP199331	ABM	100 ug	Ask for price

EIF2S2 Recombinant Protein (Mouse)
RP131258	ABM	100 ug	Ask for price

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-100ul	Abclonal	100 ul	EUR 384

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-200ul	Abclonal	200 ul	EUR 554

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-20ul	Abclonal	20 ul	Ask for price

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-50ul	Abclonal	50 ul	EUR 265

EIF2S2 ORF Vector (Human) (pORF)
ORF003462	ABM	1.0 ug DNA	EUR 95

EIF2S2 ORF Vector (Human) (pORF)
ORF003463	ABM	1.0 ug DNA	EUR 95

EIF2S2 ORF Vector (Human) (pORF)
ORF003464	ABM	1.0 ug DNA	EUR 95

Eif2s2 ORF Vector (Rat) (pORF)
ORF066445	ABM	1.0 ug DNA	EUR 506

Eif2s2 ORF Vector (Mouse) (pORF)
ORF043754	ABM	1.0 ug DNA	EUR 506

Anti-Phospho-EIF2S2-(S2) antibody
STJ22114	St John's Laboratory	100 µl	EUR 393
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

EIF2S2 sgRNA CRISPR Lentivector set (Human)
K0666501	ABM	3 x 1.0 ug	EUR 339

Eif2s2 sgRNA CRISPR Lentivector set (Rat)
K7228601	ABM	3 x 1.0 ug	EUR 339

Eif2s2 sgRNA CRISPR Lentivector set (Mouse)
K4867501	ABM	3 x 1.0 ug	EUR 339

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0666502	ABM	1.0 ug DNA	EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0666503	ABM	1.0 ug DNA	EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0666504	ABM	1.0 ug DNA	EUR 154