EIF2S2

EIF2S2 siRNA
20-abx915154
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2S2 antibody
70R-36848 100 ug
EUR 327
Description: Rabbit Polyclonal EIF2S2 antibody

EIF2S2 antibody
70R-4904 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 antibody
70R-4905 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 Antibody
ABD4050 100 ug
EUR 438

EIF2S2 Antibody
33102-100ul 100ul
EUR 252

EIF2S2 antibody
70R-17044 50 ul
EUR 435
Description: Rabbit polyclonal EIF2S2 antibody

EIF2S2 Antibody
DF4050 200ul
EUR 304
Description: EIF2S2 Antibody detects endogenous levels of total EIF2S2.

EIF2S2 Antibody
1-CSB-PA007524GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

EIF2S2 Antibody
1-CSB-PA010574
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EIF2S2 Antibody
1-CSB-PA070174
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

pOTB7-EIF2S2
PVT18393 2 ug
EUR 231

EIF2S2 Conjugated Antibody
C33102 100ul
EUR 397

EIF2S2 cloning plasmid
CSB-CL007524HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid
CSB-CL007524HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgagga
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid
CSB-CL007524HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

anti- EIF2S2 antibody
FNab02700 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
  • Uniprot ID: P20042
  • Gene ID: 8894
  • Research Area: Metabolism
Description: Antibody raised against EIF2S2

EIF2S2 (pS67) Antibody
20-abx121086
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EIF2S2 (pS2) Antibody
20-abx000391
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF2S2 Rabbit pAb
A5894-100ul 100 ul
EUR 308

EIF2S2 Rabbit pAb
A5894-200ul 200 ul
EUR 459

EIF2S2 Rabbit pAb
A5894-20ul 20 ul
EUR 183

EIF2S2 Rabbit pAb
A5894-50ul 50 ul
EUR 223

EIF2S2 Rabbit pAb
A14498-100ul 100 ul
EUR 308

EIF2S2 Rabbit pAb
A14498-200ul 200 ul
EUR 459

EIF2S2 Rabbit pAb
A14498-20ul 20 ul
EUR 183

EIF2S2 Rabbit pAb
A14498-50ul 50 ul
EUR 223

EIF2S2 Blocking Peptide
33R-1911 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4904

EIF2S2 Blocking Peptide
33R-9251 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4905

EIF2S2 Blocking Peptide
DF4050-BP 1mg
EUR 195

Anti-EIF2S2 antibody
PAab02700 100 ug
EUR 386

Anti-EIF2S2 Antibody
PA2157 100ug/vial
EUR 294

pCMV-SPORT6-EIF2S2
PVT18199 2 ug
EUR 231

pENTR223-EIF2S2 vector
PVT11718 2 ug
EUR 304

Anti-EIF2S2 antibody
STJ28167 100 µl
EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 antibody
STJ116709 100 µl
EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 (2F3)
YF-MA16593 100 ug
EUR 363
Description: Mouse monoclonal to EIF2S2

Mouse EIF2S2 shRNA Plasmid
20-abx976031
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine EIF2S2 ELISA KIT
ELI-08424b 96 Tests
EUR 928

EIF2S2 ELISA KIT|Human
EF009336 96 Tests
EUR 689

Human EIF2S2 ELISA KIT
ELI-43377h 96 Tests
EUR 824

Mouse Eif2s2 ELISA KIT
ELI-48691m 96 Tests
EUR 865

EIF2S2 (pS67) Blocking Peptide
20-abx161086
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human EIF2S2 shRNA Plasmid
20-abx955879
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-EIF2S2 (Ser2) Antibody
CSB-PA790061-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EIF2S2 (Ser2) Antibody
CSB-PA790061-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EIF2S2 (Ab-67) Antibody
CSB-PA566738-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 (Ab-67) Antibody
CSB-PA566738-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 Recombinant Protein (Human)
RP010384 100 ug Ask for price

EIF2S2 Recombinant Protein (Human)
RP010387 100 ug Ask for price

EIF2S2 Recombinant Protein (Human)
RP010390 100 ug Ask for price

pECMV-3-FLAG-EIF2S2
PVT13567 2 ug
EUR 599

EIF2S2 Recombinant Protein (Rat)
RP199331 100 ug Ask for price

EIF2S2 Recombinant Protein (Mouse)
RP131258 100 ug Ask for price

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-100ul 100 ul
EUR 384

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-200ul 200 ul
EUR 554

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-20ul 20 ul Ask for price

Phospho-EIF2S2-S2 Rabbit pAb
AP0343-50ul 50 ul
EUR 265

EIF2S2 ORF Vector (Human) (pORF)
ORF003462 1.0 ug DNA
EUR 95

EIF2S2 ORF Vector (Human) (pORF)
ORF003463 1.0 ug DNA
EUR 95

EIF2S2 ORF Vector (Human) (pORF)
ORF003464 1.0 ug DNA
EUR 95

Eif2s2 ORF Vector (Rat) (pORF)
ORF066445 1.0 ug DNA
EUR 506

Eif2s2 ORF Vector (Mouse) (pORF)
ORF043754 1.0 ug DNA
EUR 506

Anti-Phospho-EIF2S2-(S2) antibody
STJ22114 100 µl
EUR 393
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

EIF2S2 sgRNA CRISPR Lentivector set (Human)
K0666501 3 x 1.0 ug
EUR 339

Eif2s2 sgRNA CRISPR Lentivector set (Rat)
K7228601 3 x 1.0 ug
EUR 339

Eif2s2 sgRNA CRISPR Lentivector set (Mouse)
K4867501 3 x 1.0 ug
EUR 339

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0666502 1.0 ug DNA
EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0666503 1.0 ug DNA
EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0666504 1.0 ug DNA
EUR 154

Copyright © 2021 Beopenlab - WordPress Theme : by Sparkle Themes