USP44 siRNA
20-abx939236
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP44 antibody
70R-21211 50 ul
EUR 435
Description: Rabbit polyclonal USP44 antibody
USP44 Antibody
ABD4594 100 ug
EUR 438
USP44 Antibody
DF4594 200ul
EUR 304
Description: USP44 Antibody detects endogenous levels of total USP44.
USP44 Antibody
1-CSB-PA060300
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against USP44. Recognizes USP44 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
USP44 Antibody
1-CSB-PA025736GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP44. Recognizes USP44 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
pBlueScriptR-USP44
PVT17296 2 ug
EUR 258
anti- USP44 antibody
FNab09334 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: ubiquitin specific peptidase 44
  • Uniprot ID: Q9H0E7
  • Gene ID: 84101
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP44
USP44 Polyclonal Antibody
ES7728-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against USP44 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
USP44 Polyclonal Antibody
ES7728-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against USP44 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
USP44 Blocking Peptide
20-abx161752
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
USP44 Polyclonal Antibody
ABP56729-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of USP44 from Human. This USP44 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260
USP44 Polyclonal Antibody
ABP56729-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of USP44 from Human. This USP44 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260
USP44 Polyclonal Antibody
ABP56729-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of USP44 from Human. This USP44 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260
Anti-USP44 Antibody
A08401 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for USP44 Antibody (USP44) detection. Tested with WB in Human.
USP44 Rabbit pAb
A15528-100ul 100 ul
EUR 308
USP44 Rabbit pAb
A15528-200ul 200 ul
EUR 459
USP44 Rabbit pAb
A15528-20ul 20 ul
EUR 183
USP44 Rabbit pAb
A15528-50ul 50 ul
EUR 223
USP44 Polyclonal Antibody
41526-100ul 100ul
EUR 252
USP44 Polyclonal Antibody
41526-50ul 50ul
EUR 187
USP44 cloning plasmid
CSB-CL884431HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2139
  • Sequence: atgctagcaatggatacgtgcaaacatgttgggcagctgcagcttgctcaagaccattccagcctcaaccctcagaaatggcactgtgtggactgcaacacgaccgagtccatttgggcttgccttagctgctcccatgttgcctgtggaagatatattgaagagcatgcactca
  • Show more
Description: A cloning plasmid for the USP44 gene.
USP44 Blocking Peptide
DF4594-BP 1mg
EUR 195
Anti-USP44 antibody
PAab09334 100 ug
EUR 412
Anti-USP44 antibody
STJ96206 200 µl
EUR 197
Description: Rabbit polyclonal to USP44.
Anti-USP44 antibody
STJ117723 100 µl
EUR 277
Description: The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome.
USP44 Polyclonal Conjugated Antibody
C41526 100ul
EUR 397
Mouse USP44 shRNA Plasmid
20-abx983494
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP44 shRNA Plasmid
20-abx963298
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP44 ELISA KIT|Human
EF004141 96 Tests
EUR 689
Mouse Usp44 ELISA KIT
ELI-51361m 96 Tests
EUR 865
USP44 Recombinant Protein (Human)
RP034132 100 ug Ask for price
USP44 Recombinant Protein (Rat)
RP236120 100 ug Ask for price
USP44 Recombinant Protein (Mouse)
RP183455 100 ug Ask for price
USP44 Recombinant Protein (Mouse)
RP183458 100 ug Ask for price
Usp44 ORF Vector (Rat) (pORF)
ORF078708 1.0 ug DNA
EUR 506
USP44 ORF Vector (Human) (pORF)
ORF011378 1.0 ug DNA
EUR 95
Usp44 ORF Vector (Mouse) (pORF)
ORF061153 1.0 ug DNA
EUR 506
Usp44 ORF Vector (Mouse) (pORF)
ORF061154 1.0 ug DNA
EUR 506
Ubiquitin Specific Peptidase 44 (USP44) Antibody
20-abx116445
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
USP44 sgRNA CRISPR Lentivector set (Human)
K2601301 3 x 1.0 ug
EUR 339
Usp44 sgRNA CRISPR Lentivector set (Mouse)
K4696501 3 x 1.0 ug
EUR 339
Usp44 sgRNA CRISPR Lentivector set (Rat)
K6593501 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 44 (USP44) Antibody
20-abx121920
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 44 (USP44) Antibody
abx122769-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin carboxyl-terminal hydrolase 44 (USP44) Antibody
20-abx323969
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 44 (USP44) Antibody
abx239334-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
USP44 sgRNA CRISPR Lentivector (Human) (Target 1)
K2601302 1.0 ug DNA
EUR 154
USP44 sgRNA CRISPR Lentivector (Human) (Target 2)
K2601303 1.0 ug DNA
EUR 154
USP44 sgRNA CRISPR Lentivector (Human) (Target 3)
K2601304 1.0 ug DNA
EUR 154
Usp44 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4696502 1.0 ug DNA
EUR 154
Usp44 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4696503 1.0 ug DNA
EUR 154
Usp44 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4696504 1.0 ug DNA
EUR 154
Usp44 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6593502 1.0 ug DNA
EUR 154
Usp44 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6593503 1.0 ug DNA
EUR 154
Usp44 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6593504 1.0 ug DNA
EUR 154
USP44 Protein Vector (Human) (pPB-C-His)
PV045509 500 ng
EUR 329
USP44 Protein Vector (Human) (pPB-N-His)
PV045510 500 ng
EUR 329
USP44 Protein Vector (Human) (pPM-C-HA)
PV045511 500 ng
EUR 329
USP44 Protein Vector (Human) (pPM-C-His)
PV045512 500 ng
EUR 329
USP44 Protein Vector (Rat) (pPB-C-His)
PV314830 500 ng
EUR 603
USP44 Protein Vector (Rat) (pPB-N-His)
PV314831 500 ng
EUR 603
USP44 Protein Vector (Rat) (pPM-C-HA)
PV314832 500 ng
EUR 603
USP44 Protein Vector (Rat) (pPM-C-His)
PV314833 500 ng
EUR 603
USP44 Protein Vector (Mouse) (pPB-C-His)
PV244610 500 ng
EUR 1065
USP44 Protein Vector (Mouse) (pPB-N-His)
PV244611 500 ng
EUR 1065
USP44 Protein Vector (Mouse) (pPM-C-HA)
PV244612 500 ng
EUR 1065
USP44 Protein Vector (Mouse) (pPM-C-His)
PV244613 500 ng
EUR 1065
USP44 Protein Vector (Mouse) (pPB-C-His)
PV244614 500 ng
EUR 603
USP44 Protein Vector (Mouse) (pPB-N-His)
PV244615 500 ng
EUR 603
USP44 Protein Vector (Mouse) (pPM-C-HA)
PV244616 500 ng
EUR 603
USP44 Protein Vector (Mouse) (pPM-C-His)
PV244617 500 ng
EUR 603
Usp44 3'UTR GFP Stable Cell Line
TU171678 1.0 ml Ask for price
USP44 3'UTR GFP Stable Cell Line
TU078010 1.0 ml
EUR 1394
Usp44 3'UTR Luciferase Stable Cell Line
TU121678 1.0 ml Ask for price