Beopenlab

Human Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Hu-96T	DL Develop	96T	EUR 673
Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Mouse Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Rat Uromodulin (UMOD) ELISA Kit
DLR-UMOD-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.

Human Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Uromodulin (UMOD) ELISA Kit
RD-UMOD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Uromodulin (UMOD) ELISA Kit
RD-UMOD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Uromodulin (UMOD) ELISA Kit
RD-UMOD-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Uromodulin (UMOD) ELISA Kit
RD-UMOD-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Uromodulin (UMOD) ELISA Kit
RD-UMOD-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Uromodulin (UMOD) ELISA Kit
RD-UMOD-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

UMOD antibody
70R-21166	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UMOD antibody

UMOD Antibody
32498-100ul	SAB	100ul	EUR 252

UMOD Antibody
1-CSB-PA060042	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

UMOD Antibody
DF6692	Affbiotech	200ul	EUR 304
Description: UMOD Antibody detects endogenous levels of total UMOD.

UMOD antibody
70R-8504	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal UMOD antibody

UMOD Antibody
1-CSB-PA025616GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UMOD siRNA
20-abx905951	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UMOD siRNA
20-abx939015	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UMOD siRNA
20-abx939016	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UMOD Antibody
ABD6692	Lifescience Market	100 ug	EUR 438

UMOD Blocking Peptide
33R-7383	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-8504

UMOD Blocking Peptide
DF6692-BP	Affbiotech	1mg	EUR 195

Mouse Uromodulin (Umod)
1-CSB-YP025616MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 64.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uromodulin(Umod),partial expressed in Yeast

Uromodulin (UMOD) Antibody
20-abx008590	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody
20-abx178822	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Uromodulin (UMOD) Antibody
20-abx178823	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx100690	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx100691	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx100692	Abbexa	EUR 467.00 EUR 133.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx116546	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody
20-abx129707	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody
20-abx175043	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Uromodulin (UMOD) Antibody
abx239294-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

UMOD Conjugated Antibody
C32498	SAB	100ul	EUR 397

Uromodulin (UMOD) Antibody
20-abx323479	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Uromodulin (UMOD) Antibody
abx433429-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Uromodulin (UMOD) Antibody
abx433430-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

UMOD cloning plasmid
CSB-CL025616HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1836 Sequence: atggggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacctcagaagcaagatggtgctctgaatgtcacagcaatgccacctgcacggaggatgaggccgttacgacgtgcacctgtcaggagggcttcaccggcg Show more
Description: A cloning plasmid for the UMOD gene.

UMOD Rabbit pAb
A1920-100ul	Abclonal	100 ul	EUR 308

UMOD Rabbit pAb
A1920-200ul	Abclonal	200 ul	EUR 459

UMOD Rabbit pAb
A1920-20ul	Abclonal	20 ul	EUR 183

UMOD Rabbit pAb
A1920-50ul	Abclonal	50 ul	EUR 223

Uromodulin (UMOD) Antibody
20-abx001568	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Uromodulin (UMOD)
4-RPG918Ca01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q862Z3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 13.8kDa Isoelectric Point: Inquire
Description: Recombinant Dog Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)
4-RPG918Hu01	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07911 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01%skl, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: 7.1
Description: Recombinant Human Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)
4-RPG918Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q91X17 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 60.8kDa Isoelectric Point: 6.4
Description: Recombinant Mouse Uromodulin expressed in: E.coli

Recombinant Uromodulin (UMOD)
4-RPG918Ra01	Cloud-Clone	EUR 522.91 EUR 243.00 EUR 1685.92 EUR 628.64 EUR 1157.28 EUR 413.00 EUR 4064.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P27590 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Uromodulin expressed in: E.coli

Anti-UMOD antibody
STJ26043	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.

Polyclonal UMOD Antibody (Center)
APR03934G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD (Center). This antibody is tested and proven to work in the following applications:

Mouse Uromodulin (UMOD) Protein
20-abx168347	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Uromodulin (UMOD) Protein
20-abx069612	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Uromodulin (UMOD) Protein
20-abx069613	Abbexa	EUR 732.00 EUR 286.00 EUR 2277.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dog Uromodulin (UMOD) Protein
20-abx069614	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human UMOD ELISA Kit
ELA-E2280h	Lifescience Market	96 Tests	EUR 824

UMOD ELISA KIT|Human
EF006268	Lifescience Market	96 Tests	EUR 689

OVA Conjugated Uromodulin (UMOD)
4-CPG918Hu21	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07911 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Human Uromodulin expressed in: chemical synthesis

Mouse UMOD shRNA Plasmid
20-abx973312	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat UMOD shRNA Plasmid
20-abx984809	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Uromodulin (UMOD) Antibody (Biotin)
20-abx271676	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Uromodulin (UMOD) Antibody (Biotin)
20-abx272397	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uromodulin (UMOD) Antibody Pair
20-abx370002	Abbexa	EUR 1483.00 EUR 954.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Human UMOD shRNA Plasmid
20-abx955040	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UMOD Uromodulin Human protein
PROTP07911	BosterBio	Regular: 10ug	EUR 317
Description: Uromodulin Human Native protein produced from Human Urine, is a glycosylated polypeptide chain containing 590 amino acids, having a total Mw of 64.25 kDa (excluding glycosylation).

UMOD Recombinant Protein (Rat)
RP235856	ABM	100 ug	Ask for price

UMOD Recombinant Protein (Human)
RP033967	ABM	100 ug	Ask for price

UMOD Recombinant Protein (Mouse)
RP183092	ABM	100 ug	Ask for price

Rat UMOD ELISA Kit
STJ150397	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of THP in Rat serum, plasma and other biological fluids

Mouse Uromodulin(UMOD) ELISA kit
CSB-EL025616MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Uromodulin (UMOD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.