Beopenlab

TRIM25 siRNA
20-abx938030	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRIM25 antibody
70R-20982	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TRIM25 antibody

TRIM25 Antibody
43160-100ul	SAB	100ul	EUR 252

TRIM25 Antibody
24570-100ul	SAB	100ul	EUR 390

TRIM25 Antibody
24571-100ul	SAB	100ul	EUR 390

TRIM25 Antibody
CSB-PA997812-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRIM25 Antibody
CSB-PA997812-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRIM25 Antibody
1-CSB-PA617909LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TRIM25 Antibody
1-CSB-PA172995	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIM25 Antibody
1-CSB-PA054075	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TRIM25 Antibody
1-CSB-PA060115	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

TRIM25 Antibody
1-CSB-PA024461GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

anti-TRIM25
YF-PA15423	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TRIM25

anti-TRIM25
YF-PA15424	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to TRIM25

anti-TRIM25
YF-PA15425	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TRIM25

anti-TRIM25
YF-PA24996	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TRIM25

E3 Ubiquitin/ISG15 Ligase TRIM25 (TRIM25) Antibody
abx224319-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

TRIM25 Conjugated Antibody
C43160	SAB	100ul	EUR 397

Polyclonal TRIM25 Antibody
APR06458G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 . This antibody is tested and proven to work in the following applications:

Polyclonal TRIM25 Antibody
APR06459G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 . This antibody is tested and proven to work in the following applications:

TRIM25 cloning plasmid
CSB-CL617909HU-10ug	Cusabio	10ug	EUR 640
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1893 Sequence: atggcagagctgtgccccctggccgaggagctgtcgtgctccatctgcctggagcccttcaaggagccggtcaccactccgtgcggccacaacttctgcgggtcgtgcctgaatgagacgtgggcagtccagggctcgccatacctgtgcccgcagtgccgcgccgtctaccagg Show more
Description: A cloning plasmid for the TRIM25 gene.

anti- TRIM25 antibody
FNab08976	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:2000 IP: 1:200-1:2000 IF: 1:20-1:200 Immunogen: tripartite motif-containing 25 Uniprot ID: Q14258 Gene ID: 7706 Research Area: Epigenetics, Immunology, Metabolism
Description: Antibody raised against TRIM25

TRIM25 Blocking Peptide
20-abx061223	Abbexa	EUR 286.00 EUR 425.00	1 mg 5 mg
Shipped within 5-10 working days.

TRIM25 Antibody (HRP)
20-abx315016	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TRIM25 Antibody (FITC)
20-abx315017	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TRIM25 Antibody (Biotin)
20-abx315018	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TRIM25 Rabbit pAb
A12938-100ul	Abclonal	100 ul	EUR 308

TRIM25 Rabbit pAb
A12938-200ul	Abclonal	200 ul	EUR 459

TRIM25 Rabbit pAb
A12938-20ul	Abclonal	20 ul	EUR 183

TRIM25 Rabbit pAb
A12938-50ul	Abclonal	50 ul	EUR 223

TRIM25 Rabbit mAb
A4347-100ul	Abclonal	100 ul	EUR 410

TRIM25 Rabbit mAb
A4347-200ul	Abclonal	200 ul	EUR 571

TRIM25 Rabbit mAb
A4347-20ul	Abclonal	20 ul	EUR 221

TRIM25 Rabbit mAb
A4347-50ul	Abclonal	50 ul	EUR 287

Anti-TRIM25 antibody
PAab08976	Lifescience Market	100 ug	EUR 412

pCAGGS-HA-TRIM25
PVT14013	Lifescience Market	2 ug	EUR 599

Anti-TRIM25 antibody
STJ11100763	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene.

Anti-TRIM25 antibody
STJ114804	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene.

Anti-TRIM25 (2B12)
YF-MA16180	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRIM25

Anti-TRIM25 (5F12)
YF-MA16181	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRIM25

Anti-TRIM25 (5C3)
YF-MA11023	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRIM25

Mouse E3 ubiquitin/ISG15 ligase TRIM25, Trim25 ELISA KIT
ELI-29036m	Lifescience Market	96 Tests	EUR 865

Human E3 ubiquitin/ISG15 ligase TRIM25, TRIM25 ELISA KIT
ELI-40165h	Lifescience Market	96 Tests	EUR 824

Polyclonal TRIM25 Antibody (Center)
APR04146G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 (Center). This antibody is tested and proven to work in the following applications:

Mouse TRIM25 shRNA Plasmid
20-abx981073	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRIM25 ELISA KIT|Human
EF003821	Lifescience Market	96 Tests	EUR 689

Human TRIM25 shRNA Plasmid
20-abx955224	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRIM25 Antibody, HRP conjugated
1-CSB-PA617909LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIM25 Antibody, FITC conjugated
1-CSB-PA617909LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIM25 Antibody, Biotin conjugated
1-CSB-PA617909LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TRIM25 Monoclonal Antibody
M03232	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal TRIM25 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

TRIM25 Recombinant Protein (Human)
RP032893	ABM	100 ug	Ask for price

TRIM25 Recombinant Protein (Rat)
RP234665	ABM	100 ug	Ask for price

TRIM25 Recombinant Protein (Mouse)
RP181088	ABM	100 ug	Ask for price

pECMV-3-FLAG-TRIM25
PVT12769	Lifescience Market	2 ug	EUR 703

Polyclonal TRIM25 Antibody (C-Terminus)
APR02517G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 (C-Terminus). This antibody is tested and proven to work in the following applications:

[KO Validated] TRIM25 Rabbit pAb
A19887-100ul	Abclonal	100 ul	EUR 410

[KO Validated] TRIM25 Rabbit pAb
A19887-200ul	Abclonal	200 ul	EUR 571

[KO Validated] TRIM25 Rabbit pAb
A19887-20ul	Abclonal	20 ul	EUR 221

[KO Validated] TRIM25 Rabbit pAb
A19887-50ul	Abclonal	50 ul	EUR 287

Trim25 ORF Vector (Rat) (pORF)
ORF078223	ABM	1.0 ug DNA	EUR 506

TRIM25 ORF Vector (Human) (pORF)
ORF010965	ABM	1.0 ug DNA	EUR 95

Trim25 ORF Vector (Mouse) (pORF)
ORF060364	ABM	1.0 ug DNA	EUR 506

Tripartite Motif-Containing 25 (TRIM25) Antibody
20-abx116274	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx133641	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx004556	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
abx029113-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
abx029113-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx324422	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx339143	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
abx331231-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
abx238976-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx302574	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
abx224437-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody
20-abx210308	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.