Beopenlab

Ssr1/ Rat Ssr1 ELISA Kit
ELI-41774r	Lifescience Market	96 Tests	EUR 886

Human TRAPA/SSR1 (SSR1) ELISA Kit
abx392142-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SSR1 antibody
70R-20537	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SSR1 antibody

SSR1 antibody
10R-5935	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SSR1 antibody

SSR1 antibody
10R-5936	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SSR1 antibody

SSR1 antibody
10R-5937	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SSR1 antibody

SSR1 antibody
10R-5938	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SSR1 antibody

SSR1 antibody
10R-5939	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SSR1 antibody

SSR1 antibody
10R-5940	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal SSR1 antibody

SSR1 Antibody
45250-100ul	SAB	100ul	EUR 252

SSR1 Antibody
45250-50ul	SAB	50ul	EUR 187

SSR1 Antibody
DF8244	Affbiotech	200ul	EUR 304
Description: SSR1 Antibody detects endogenous levels of total SSR1.

SSR1 antibody
70R-6619	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SSR1 antibody raised against the middle region of SSR1

SSR1 antibody
70R-7311	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SSR1 antibody

SSR1 Antibody
1-CSB-PA022717GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SSR1. Recognizes SSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SSR1 siRNA
20-abx935264	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SSR1 siRNA
20-abx935265	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SSR1 Antibody
ABD8244	Lifescience Market	100 ug	EUR 438

SSR1 Blocking Peptide
33R-1878	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSR1 antibody, catalog no. 70R-7311

SSR1 Blocking Peptide
33R-3096	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSR1 antibody, catalog no. 70R-6619

SSR1 Blocking Peptide
DF8244-BP	Affbiotech	1mg	EUR 195

SSR1 Conjugated Antibody
C45250	SAB	100ul	EUR 397

SSR1 cloning plasmid
CSB-CL022717HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 861 Sequence: atgagactcctcccccgcttgctgctgcttctcttactcgtgttccctgccactgtcttgttccgaggcggccccagaggcttgttagcagtggcacaagatcttacagaggatgaagaaacagtagaagattccataattgaggatgaagatgatgaagccgaggtagaagaaga Show more
Description: A cloning plasmid for the SSR1 gene.

SSR1 Rabbit pAb
A4129-100ul	Abclonal	100 ul	EUR 308

SSR1 Rabbit pAb
A4129-200ul	Abclonal	200 ul	EUR 459

SSR1 Rabbit pAb
A4129-20ul	Abclonal	20 ul	EUR 183

SSR1 Rabbit pAb
A4129-50ul	Abclonal	50 ul	EUR 223

Anti-SSR1 antibody
STJ111212	St John's Laboratory	100 µl	EUR 277
Description: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene.

SSR1 protein (His tag)
80R-3565	Fitzgerald	20 ug	EUR 327
Description: Purified recombinant SSR1 protein (His tag)

Mouse Ssr1 ELISA KIT
ELI-18143m	Lifescience Market	96 Tests	EUR 865

Human SSR1 ELISA KIT
ELI-18917h	Lifescience Market	96 Tests	EUR 824

Bovine SSR1 ELISA KIT
ELI-53294b	Lifescience Market	96 Tests	EUR 928

Human SSR1 shRNA Plasmid
20-abx954608	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SSR1 shRNA Plasmid
20-abx979807	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- TRAPA/SSR1 antibody
FNab08942	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: signal sequence receptor, alpha Uniprot ID: P43307 Research Area: Metabolism
Description: Antibody raised against TRAPA/SSR1

Canine SSR1 ELISA KIT
ELI-41773d	Lifescience Market	96 Tests	EUR 928

Anti-TRAPA/SSR1 antibody
PAab08942	Lifescience Market	100 ug	EUR 412

SSR1 Recombinant Protein (Rat)
RP231182	ABM	100 ug	Ask for price

SSR1 Recombinant Protein (Human)
RP030169	ABM	100 ug	Ask for price

SSR1 Recombinant Protein (Mouse)
RP175634	ABM	100 ug	Ask for price

Polyclonal SSR1 Antibody (N-term)
AMM07988G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSR1 (N-term). This antibody is tested and proven to work in the following applications:

TRAPA/SSR1 ELISA KIT|Human
EF003794	Lifescience Market	96 Tests	EUR 689

Ssr1 ORF Vector (Rat) (pORF)
ORF077062	ABM	1.0 ug DNA	EUR 506

SSR1 ORF Vector (Human) (pORF)
ORF010057	ABM	1.0 ug DNA	EUR 95

Ssr1 ORF Vector (Mouse) (pORF)
ORF058546	ABM	1.0 ug DNA	EUR 506

Ssr1 sgRNA CRISPR Lentivector set (Rat)
K6235501	ABM	3 x 1.0 ug	EUR 339

Ssr1 sgRNA CRISPR Lentivector set (Mouse)
K3672001	ABM	3 x 1.0 ug	EUR 339

SSR1 sgRNA CRISPR Lentivector set (Human)
K2290301	ABM	3 x 1.0 ug	EUR 339

Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
abx028061-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
abx028061-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
20-abx218772	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
20-abx126652	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Translocon-Associated Protein Subunit Alpha (SSR1) Protein
20-abx263394	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Ssr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6235502	ABM	1.0 ug DNA	EUR 154

Ssr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6235503	ABM	1.0 ug DNA	EUR 154

Ssr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6235504	ABM	1.0 ug DNA	EUR 154

Ssr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3672002	ABM	1.0 ug DNA	EUR 154

Ssr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3672003	ABM	1.0 ug DNA	EUR 154

Ssr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3672004	ABM	1.0 ug DNA	EUR 154

SSR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2290302	ABM	1.0 ug DNA	EUR 154

SSR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2290303	ABM	1.0 ug DNA	EUR 154

SSR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2290304	ABM	1.0 ug DNA	EUR 154

SSR1 Protein Vector (Rat) (pPB-C-His)
PV308246	ABM	500 ng	EUR 603

SSR1 Protein Vector (Rat) (pPB-N-His)
PV308247	ABM	500 ng	EUR 603

SSR1 Protein Vector (Rat) (pPM-C-HA)
PV308248	ABM	500 ng	EUR 603

SSR1 Protein Vector (Rat) (pPM-C-His)
PV308249	ABM	500 ng	EUR 603

SSR1 Protein Vector (Human) (pPB-C-His)
PV040225	ABM	500 ng	EUR 329

SSR1 Protein Vector (Human) (pPB-N-His)
PV040226	ABM	500 ng	EUR 329

SSR1 Protein Vector (Human) (pPM-C-HA)
PV040227	ABM	500 ng	EUR 329

SSR1 Protein Vector (Human) (pPM-C-His)
PV040228	ABM	500 ng	EUR 329

SSR1 Protein Vector (Mouse) (pPB-C-His)
PV234182	ABM	500 ng	EUR 603

SSR1 Protein Vector (Mouse) (pPB-N-His)
PV234183	ABM	500 ng	EUR 603

SSR1 Protein Vector (Mouse) (pPM-C-HA)
PV234184	ABM	500 ng	EUR 603

SSR1 Protein Vector (Mouse) (pPM-C-His)
PV234185	ABM	500 ng	EUR 603

Recombinant Human SSR1 Protein, His, E.coli-100ug
QP13594-100ug	EnQuireBio	100ug	EUR 1261

Recombinant Human SSR1 Protein, His, E.coli-10ug
QP13594-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human SSR1 Protein, His, E.coli-2ug
QP13594-2ug	EnQuireBio	2ug	EUR 155

Ssr1 3'UTR Luciferase Stable Cell Line
TU119739	ABM	1.0 ml	Ask for price

Ssr1 3'UTR GFP Stable Cell Line
TU169739	ABM	1.0 ml	Ask for price

Ssr1 3'UTR Luciferase Stable Cell Line
TU221220	ABM	1.0 ml	Ask for price

SSR1 3'UTR GFP Stable Cell Line
TU074664	ABM	1.0 ml	EUR 4617

Ssr1 3'UTR GFP Stable Cell Line
TU271220	ABM	1.0 ml	Ask for price

SSR1 3'UTR Luciferase Stable Cell Line
TU024664	ABM	1.0 ml	EUR 4617

Rabbit Translocon- associated protein subunit alpha, SSR1 ELISA
ELI-18678Ra	Lifescience Market	96 Tests	EUR 928

SSR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV648973	ABM	1.0 ug DNA	EUR 514