RPS27A (RPS27A) Antibody
abx146456-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
RPS27A (RPS27A) Antibody
20-abx338813
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS27A (RPS27A) Antibody
abx237471-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
RPS27A (RPS27A) Antibody
20-abx001644
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
RPS27A (RPS27A) Antibody (HRP)
20-abx338203
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS27A (RPS27A) Antibody (FITC)
20-abx338204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS27A (RPS27A) Antibody (Biotin)
20-abx338205
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps27a/ Rat Rps27a ELISA Kit
ELI-20194r 96 Tests
EUR 886
RPS27A antibody
38336-100ul 100ul
EUR 252
RPS27A Antibody
CSB-PA094989-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
RPS27A Antibody
CSB-PA094989-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
RPS27A Antibody
DF6761 200ul
EUR 304
Description: RPS27A Antibody detects endogenous levels of total RPS27A.
RPS27A Antibody
1-CSB-PA01639A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
RPS27A antibody
70R-9769 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RPS27A antibody
RPS27A Antibody
CSB-PA020420KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
RPS27A Antibody
CSB-PA020420KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
RPS27A Antibody
abx331395-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
RPS27A siRNA
20-abx904702
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS27A siRNA
20-abx932069
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS27A siRNA
20-abx932070
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS27A Antibody
ABD6761 100 ug
EUR 438
pOTB7-RPS27A
PVT18915 2 ug
EUR 231
anti-RPS27A
YF-PA14459 100 ug
EUR 403
Description: Rabbit polyclonal to RPS27A
anti-RPS27A
YF-PA24633 50 ul
EUR 334
Description: Mouse polyclonal to RPS27A
RPS27A Rabbit pAb
A14618-100ul 100 ul
EUR 308
RPS27A Rabbit pAb
A14618-200ul 200 ul
EUR 459
RPS27A Rabbit pAb
A14618-20ul 20 ul
EUR 183
RPS27A Rabbit pAb
A14618-50ul 50 ul
EUR 223
RPS27A Blocking Peptide
33R-5359 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS27A antibody, catalog no. 70R-9769
RPS27A Blocking Peptide
DF6761-BP 1mg
EUR 195
RPS27A Conjugated Antibody
C38336 100ul
EUR 397
RPS27A cloning plasmid
CSB-CL020420HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 471
  • Sequence: atgcagattttcgtgaaaacccttacggggaagaccatcaccctcgaggttgaaccctcggatacgatagaaaatgtaaaggccaagatccaggataaggaaggaattcctcctgatcagcagagactgatctttgctggcaagcagctggaagatggacgtactttgtctgacta
  • Show more
Description: A cloning plasmid for the RPS27A gene.
RPS27A Rabbit pAb
A2027-100ul 100 ul
EUR 308
RPS27A Rabbit pAb
A2027-200ul 200 ul
EUR 459
RPS27A Rabbit pAb
A2027-20ul 20 ul
EUR 183
RPS27A Rabbit pAb
A2027-50ul 50 ul
EUR 223
anti- RPS27A antibody
FNab07471 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ribosomal protein S27a
  • Uniprot ID: P62979
  • Gene ID: 6233
  • Research Area: Immunology, Metabolism
Description: Antibody raised against RPS27A
Anti-RPS27A antibody
PAab07471 100 ug
EUR 386
Anti-RPS27A antibody
STJ25406 100 µl
EUR 277
Description: Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.
Anti-RPS27A antibody
STJ116826 100 µl
EUR 277
Description: Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.
Anti-RPS27A (2G10)
YF-MA15280 100 ug
EUR 363
Description: Mouse monoclonal to RPS27A
RPS27A Antibody, HRP conjugated
1-CSB-PA01639B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS27A Antibody, FITC conjugated
1-CSB-PA01639C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS27A Antibody, Biotin conjugated
1-CSB-PA01639D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS27A. Recognizes RPS27A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RPS27A ELISA KIT|Human
EF007428 96 Tests
EUR 689
Rat RPS27A shRNA Plasmid
20-abx991268
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RPS27A shRNA Plasmid
20-abx978884
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPS27A shRNA Plasmid
20-abx954196
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS27A Recombinant Protein (Human)
RP027169 100 ug Ask for price
RPS27A Recombinant Protein (Mouse)
RP169244 100 ug Ask for price
RPS27A Recombinant Protein (Mouse)
RP169247 100 ug Ask for price
RPS27A Recombinant Protein (Rat)
RP226841 100 ug Ask for price
Anti-RPS27A (3E2-E6)
YF-MA15279 100 ug
EUR 363
Description: Mouse monoclonal to RPS27A
UBB/UBC/RPS27A/UBA52 Antibody
1-CSB-PA004354
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBB/UBC/RPS27A/UBA52. Recognizes UBB/UBC/RPS27A/UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA005763
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA005933
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA006103
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
UBB/UBC/RPS27A/UBA52 Antibody
1-CSB-PA374539
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against UBB/UBC/RPS27A/UBA52. Recognizes UBB/UBC/RPS27A/UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000
UBB / UBC / RPS27A / UBA52 Antibody
20-abx326873
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327342
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327433
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327720
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBB / UBC / RPS27A / UBA52 Antibody
20-abx328678
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps27a ORF Vector (Rat) (pORF)
ORF075615 1.0 ug DNA
EUR 506
RPS27A ORF Vector (Human) (pORF)
ORF009057 1.0 ug DNA
EUR 95
Rps27a ORF Vector (Mouse) (pORF)
ORF056416 1.0 ug DNA
EUR 506
Rps27a ORF Vector (Mouse) (pORF)
ORF056417 1.0 ug DNA
EUR 506
RPS27A Ubiquitin Human Recombinant Protein
PROTP62988-1 Regular: 50ug
EUR 317
Description: Ubiquitin Human Recombinant expressed in E.coli and purified by ion-exchange chromatography, contains 76 amino acids and has an Mw of 8.6kDa.
RPS27A ELISA Kit (Human) (OKWB00213)
OKWB00213 96 Wells
EUR 572
Description: Description of target: Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling. 40S Ribosomal protein S27a: Component of the 40S subunit of the ribosome. ;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 37.5 pg/mL
Rps27a sgRNA CRISPR Lentivector set (Rat)
K7030501 3 x 1.0 ug
EUR 339
Rps27a sgRNA CRISPR Lentivector set (Mouse)
K4501801 3 x 1.0 ug
EUR 339
RPS27A sgRNA CRISPR Lentivector set (Human)
K2054201 3 x 1.0 ug
EUR 339
Acetyl-UBA52/RPS27A/UBB/UBC (K27) Antibody
1-CSB-PA000137
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K27). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K27) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52/RPS27A/UBB/UBC (K29) Antibody
1-CSB-PA000143
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K29). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K29) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52/RPS27A/UBB/UBC (K33) Antibody
1-CSB-PA000144
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K33). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K33) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52/RPS27A/UBB/UBC (K48) Antibody
1-CSB-PA000145
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K48). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K48) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52 / RPS27A / UBB / UBC (K27) Antibody
20-abx327497
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acetyl-UBA52 / RPS27A / UBB / UBC (K29) Antibody
20-abx327498
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acetyl-UBA52 / RPS27A / UBB / UBC (K33) Antibody
20-abx327499
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acetyl-UBA52 / RPS27A / UBB / UBC (K48) Antibody
20-abx327500
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps27a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7030502 1.0 ug DNA
EUR 154
Rps27a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7030503 1.0 ug DNA
EUR 154
Rps27a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7030504 1.0 ug DNA
EUR 154
Rps27a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4501802 1.0 ug DNA
EUR 154
Rps27a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4501803 1.0 ug DNA
EUR 154