RPL14 Antibody

ABD8718 100 ug
EUR 438

RPL14 antibody

70R-33942 100 ug
EUR 327
Description: Rabbit polyclonal RPL14 antibody

RPL14 antibody

39131-100ul 100ul
EUR 252

RPL14 Antibody

34347-100ul 100ul
EUR 252

RPL14 Antibody

34347-50ul 50ul
EUR 187

RPL14 antibody

22339-100ul 100ul
EUR 390

RPL14 antibody

70R-19966 50 ul
EUR 435
Description: Rabbit polyclonal RPL14 antibody

RPL14 antibody

70R-12586 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RPL14 antibody

RPL14 antibody

70R-10352 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RPL14 antibody

RPL14 Antibody

DF8718 200ul
EUR 304
Description: RPL14 Antibody detects endogenous levels of total RPL14.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL14 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL14 Antibody

CSB-PA961640-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL14 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPL14 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

RPL14 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


PVT18750 2 ug
EUR 231


YF-PA16045 50 ug
EUR 363
Description: Mouse polyclonal to RPL14


YF-PA16046 100 ul
EUR 403
Description: Rabbit polyclonal to RPL14

RPL14 Conjugated Antibody

C39131 100ul
EUR 397

RPL14 cloning plasmid

CSB-CL020142HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactga
  • Show more
Description: A cloning plasmid for the RPL14 gene.

RPL14 cloning plasmid

CSB-CL020142HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactga
  • Show more
Description: A cloning plasmid for the RPL14 gene.

RPL14 cloning plasmid

CSB-CL020142HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactga
  • Show more
Description: A cloning plasmid for the RPL14 gene.

RPL14 cloning plasmid

CSB-CL020142HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactga
  • Show more
Description: A cloning plasmid for the RPL14 gene.

RPL14 cloning plasmid

CSB-CL020142HU5-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactga
  • Show more
Description: A cloning plasmid for the RPL14 gene.

anti- RPL14 antibody

FNab07414 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ribosomal protein L14
  • Uniprot ID: P50914
  • Gene ID: 9045
  • Research Area: Metabolism
Description: Antibody raised against RPL14

RPL14 Polyclonal Antibody

A52992 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL14 Rabbit pAb

A13384-100ul 100 ul
EUR 308

RPL14 Rabbit pAb

A13384-200ul 200 ul
EUR 459

RPL14 Rabbit pAb

A13384-20ul 20 ul
EUR 183

RPL14 Rabbit pAb

A13384-50ul 50 ul
EUR 223

RPL14 Rabbit pAb

A19461-100ul 100 ul Ask for price

RPL14 Rabbit pAb

A19461-200ul 200 ul Ask for price

RPL14 Rabbit pAb

A19461-20ul 20 ul Ask for price

RPL14 Rabbit pAb

A19461-50ul 50 ul
EUR 308

RPL14 Rabbit pAb

A6724-100ul 100 ul
EUR 308

RPL14 Rabbit pAb

A6724-200ul 200 ul
EUR 459

RPL14 Rabbit pAb

A6724-20ul 20 ul
EUR 183

RPL14 Rabbit pAb

A6724-50ul 50 ul
EUR 223

RPL14 Blocking Peptide

33R-4445 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL14 antibody, catalog no. 70R-10352

RPL14 Blocking Peptide

DF8718-BP 1mg
EUR 195

Anti-RPL14 antibody

PAab07414 100 ug
EUR 386

Anti-RPL14 antibody

STJ28807 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL14 antibody

STJ11100654 50 µl
EUR 287
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL14 antibody

STJ115346 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL14 (1B4)

YF-MA11140 100 ug
EUR 363
Description: Mouse monoclonal to RPL14

Mouse RPL14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002571 96 Tests
EUR 689

Human RPL14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL14 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL14 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL14 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL14. Recognizes RPL14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL14 Recombinant Protein (Human)

RP026854 100 ug Ask for price

RPL14 Recombinant Protein (Human)

RP026857 100 ug Ask for price

RPL14 Recombinant Protein (Human)

RP026860 100 ug Ask for price

RPL14 Recombinant Protein (Human)

RP026863 100 ug Ask for price

RPL14 Recombinant Protein (Human)

RP026866 100 ug Ask for price

RPL14 Recombinant Protein (Rat)

RP226610 100 ug Ask for price

pCMV-SPORT6-RPL14 Plasmid

PVT16146 2 ug
EUR 325

pCMV-SPORT6-RPL14 Plasmid

PVT16427 2 ug
EUR 325

RPL14 Recombinant Protein (Mouse)

RP168971 100 ug Ask for price

Ribosomal Protein L14 (RPL14) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

abx145152-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

abx331141-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L14 (RPL14) Antibody

abx237414-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL14 Polyclonal Antibody, Biotin Conjugated

A52989 100 µg
EUR 570.55
Description: The best epigenetics products

RPL14 Polyclonal Antibody, FITC Conjugated

A52990 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL14 Polyclonal Antibody, HRP Conjugated

A52991 100 µg
EUR 570.55
Description: fast delivery possible

RPL14 ORF Vector (Human) (pORF)

ORF008952 1.0 ug DNA
EUR 95

RPL14 ORF Vector (Human) (pORF)

ORF008953 1.0 ug DNA
EUR 95

RPL14 ORF Vector (Human) (pORF)

ORF008954 1.0 ug DNA
EUR 95

RPL14 ORF Vector (Human) (pORF)

ORF008955 1.0 ug DNA
EUR 95

RPL14 ORF Vector (Human) (pORF)

ORF008956 1.0 ug DNA
EUR 95

Rpl14 ORF Vector (Mouse) (pORF)

ORF056325 1.0 ug DNA
EUR 506

Rpl14 ORF Vector (Rat) (pORF)

ORF075538 1.0 ug DNA
EUR 506

[One Step] RPL14 Antibody Kit

RK05698 50 ul
EUR 240

60S Ribosomal Protein L14 (RPL14) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RPL14/Ribosomal Protein L14 Antibody

A07781 100ul
EUR 397
Description: Rabbit Polyclonal RPL14/Ribosomal Protein L14 Antibody. Validated in WB and tested in Human.

RPL14 sgRNA CRISPR Lentivector set (Human)

K1909701 3 x 1.0 ug
EUR 339