RNF40 antibody

70R-1057 100 ug
EUR 377
Description: Rabbit polyclonal RNF40 antibody raised against the C terminal of RNF40

RNF40 antibody

70R-19929 50 ul
EUR 435
Description: Rabbit polyclonal RNF40 antibody

RNF40 antibody

38921-100ul 100ul
EUR 252

RNF40 Antibody

43326-100ul 100ul
EUR 252

RNF40 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RNF40 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RNF40 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25413 50 ul
EUR 334
Description: Mouse polyclonal to RNF40

RNF40 Blocking Peptide

33R-4520 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF40 antibody, catalog no. 70R-1057

RNF40 Conjugated Antibody

C43326 100ul
EUR 397

RNF40 Conjugated Antibody

C38921 100ul
EUR 397

RNF40 cloning plasmid

CSB-CL019890HU-10ug 10ug
EUR 1112
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3006
  • Sequence: atgtctgggccaggcaacaaacgcgccgccggcgacgggggctcagggcccccggaaaagaagctgagtcgtgaggagaagaccaccacgactcttatcgagcccattcgtcttggaggcatctcttccacggaggagatggacctgaaggtactacagttcaagaacaagaaac
  • Show more
Description: A cloning plasmid for the RNF40 gene.

RNF40 Rabbit pAb

A6443-100ul 100 ul
EUR 308

RNF40 Rabbit pAb

A6443-200ul 200 ul
EUR 459

RNF40 Rabbit pAb

A6443-20ul 20 ul
EUR 183

RNF40 Rabbit pAb

A6443-50ul 50 ul
EUR 223

anti- RNF40 antibody

FNab07358 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:20 - 1:100
  • ChIP : 1:50 - 1:200
  • Immunogen: ring finger protein 40
  • Uniprot ID: O75150
  • Gene ID: 9810
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against RNF40

Anti-RNF40 antibody

PAab07358 100 ug
EUR 386

Anti-RNF40 antibody

STJ28526 100 µl
EUR 277
Description: The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RNF40 (1C1)

YF-MA17009 100 ug
EUR 363
Description: Mouse monoclonal to RNF40


EF002526 96 Tests
EUR 689

Rat RNF40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNF40 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF40 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF40 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RNF40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RNF40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rnf40 ORF Vector (Rat) (pORF)

ORF075484 1.0 ug DNA
EUR 506

RNF40 ORF Vector (Human) (pORF)

ORF008897 1.0 ug DNA
EUR 95

Rnf40 ORF Vector (Mouse) (pORF)

ORF056223 1.0 ug DNA
EUR 506

Ring Finger Protein 40 (RNF40) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

abx027996-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

abx027996-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

abx145732-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody

abx237358-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ring Finger Protein 40 (RNF40) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rnf40 sgRNA CRISPR Lentivector set (Mouse)

K4886301 3 x 1.0 ug
EUR 339

Rnf40 sgRNA CRISPR Lentivector set (Rat)

K7369401 3 x 1.0 ug
EUR 339

RNF40 sgRNA CRISPR Lentivector set (Human)

K1836301 3 x 1.0 ug
EUR 339

Ring Finger Protein 40 (RNF40) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal RNF40 Antibody (monoclonal) (M09), Clone: 1C1

AMM04029G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RNF40 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1C1. This antibody is applicable in WB and IF, E

Rnf40 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4886302 1.0 ug DNA
EUR 154

Rnf40 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4886303 1.0 ug DNA
EUR 154

Rnf40 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4886304 1.0 ug DNA
EUR 154

Rnf40 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7369402 1.0 ug DNA
EUR 154

Rnf40 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7369403 1.0 ug DNA
EUR 154

Rnf40 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7369404 1.0 ug DNA
EUR 154

RNF40 sgRNA CRISPR Lentivector (Human) (Target 1)

K1836302 1.0 ug DNA
EUR 154

RNF40 sgRNA CRISPR Lentivector (Human) (Target 2)

K1836303 1.0 ug DNA
EUR 154

RNF40 sgRNA CRISPR Lentivector (Human) (Target 3)

K1836304 1.0 ug DNA
EUR 154

RNF40 Protein Vector (Rat) (pPB-C-His)

PV301934 500 ng
EUR 1166

RNF40 Protein Vector (Rat) (pPB-N-His)

PV301935 500 ng
EUR 1166

RNF40 Protein Vector (Rat) (pPM-C-HA)

PV301936 500 ng
EUR 1166

RNF40 Protein Vector (Rat) (pPM-C-His)

PV301937 500 ng
EUR 1166

RNF40 Protein Vector (Human) (pPB-C-His)

PV035585 500 ng
EUR 329

RNF40 Protein Vector (Human) (pPB-N-His)

PV035586 500 ng
EUR 329

RNF40 Protein Vector (Human) (pPM-C-HA)

PV035587 500 ng
EUR 329

RNF40 Protein Vector (Human) (pPM-C-His)

PV035588 500 ng
EUR 329

RNF40 Protein Vector (Mouse) (pPB-C-His)

PV224890 500 ng
EUR 1065

RNF40 Protein Vector (Mouse) (pPB-N-His)

PV224891 500 ng
EUR 1065

RNF40 Protein Vector (Mouse) (pPM-C-HA)

PV224892 500 ng
EUR 1065

RNF40 Protein Vector (Mouse) (pPM-C-His)

PV224893 500 ng
EUR 1065

Rnf40 3'UTR Luciferase Stable Cell Line

TU118011 1.0 ml Ask for price

Rnf40 3'UTR GFP Stable Cell Line

TU168011 1.0 ml Ask for price

Rnf40 3'UTR Luciferase Stable Cell Line

TU219560 1.0 ml Ask for price

Rnf40 3'UTR GFP Stable Cell Line

TU269560 1.0 ml Ask for price

RNF40 3'UTR GFP Stable Cell Line

TU070047 1.0 ml
EUR 2333

RNF40 3'UTR Luciferase Stable Cell Line

TU020047 1.0 ml
EUR 2333

Human Ring Finger Protein 40 (RNF40) ELISA Kit

abx382860-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RNF40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV666889 1.0 ug DNA
EUR 1355

RNF40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV666893 1.0 ug DNA
EUR 1355

RNF40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV666894 1.0 ug DNA
EUR 1355

Human E3 ubiquitin- protein ligase BRE1B, RNF40 ELISA KIT

ELI-33328h 96 Tests
EUR 824

Mouse E3 ubiquitin- protein ligase BRE1B, Rnf40 ELISA KIT

ELI-33329m 96 Tests
EUR 865

Rnf40 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4886305 3 x 1.0 ug
EUR 376

Rnf40 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7369405 3 x 1.0 ug
EUR 376

RNF40 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1836305 3 x 1.0 ug
EUR 376