Beopenlab

Human RAD23 Homolog B (RAD23B) ELISA Kit
DLR-RAD23B-Hu-96T	DL Develop	96T	EUR 725
Should the Human RAD23 Homolog B (RAD23B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAD23 Homolog B (RAD23B) in samples from tissue homogenates or other biological fluids.

Human RAD23 Homolog B (RAD23B) ELISA Kit
RD-RAD23B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human RAD23 Homolog B (RAD23B) ELISA Kit
RD-RAD23B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human RAD23 Homolog B (RAD23B) ELISA Kit
RDR-RAD23B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human RAD23 Homolog B (RAD23B) ELISA Kit
RDR-RAD23B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Rad23b/ Rat Rad23b ELISA Kit
ELI-44358r	Lifescience Market	96 Tests	EUR 886

RAD23B siRNA
20-abx904448	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAD23B siRNA
20-abx930767	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAD23B siRNA
20-abx930768	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAD23B antibody
70R-50301	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal RAD23B antibody

RAD23B antibody
70R-3307	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAD23B antibody

RAD23B antibody
70R-3309	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAD23B antibody

RAD23B Antibody
ABD4645	Lifescience Market	100 ug	EUR 438

RAD23B Antibody
35170-100ul	SAB	100ul	EUR 252

RAD23B Antibody
35170-50ul	SAB	50ul	EUR 187

RAD23B Antibody
47184-100ul	SAB	100ul	EUR 252

RAD23B antibody
10R-1627	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal RAD23B antibody

RAD23B antibody
70R-19746	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAD23B antibody

RAD23B Antibody
DF4645	Affbiotech	200ul	EUR 304
Description: RAD23B Antibody detects endogenous levels of total RAD23B.

RAD23B Antibody
1-CSB-PA003914	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

RAD23B Antibody
1-CSB-PA019260GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAD23B Antibody
1-CSB-PA019260LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAD23B Conjugated Antibody
C47184	SAB	100ul	EUR 397

RAD23B Conjugated Antibody
C35170	SAB	100ul	EUR 397

RAD23B cloning plasmid
CSB-CL019260HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1230 Sequence: atgcaggtcaccctgaagaccctccagcagcagaccttcaagatagacattgaccccgaggagacggtgaaagcactgaaagagaagattgaatctgaaaaggggaaagatgcctttccagtagcaggtcaaaaattaatttatgcaggcaaaatcctcaatgatgatactgctc Show more
Description: A cloning plasmid for the RAD23B gene.

Rad23B Polyclonal Antibody
ES3305-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Rad23B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Rad23B Polyclonal Antibody
ES3305-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Rad23B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- RAD23B antibody
FNab07078	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:100 - 1:200 Immunogen: RAD23 homolog B (S. cerevisiae) Uniprot ID: P54727 Gene ID: 5887 Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against RAD23B

Rad23B Polyclonal Antibody
ABP52306-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90 Applications tips:
Description: A polyclonal antibody for detection of Rad23B from Human, Mouse, Rat. This Rad23B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90

Rad23B Polyclonal Antibody
ABP52306-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90 Applications tips:
Description: A polyclonal antibody for detection of Rad23B from Human, Mouse, Rat. This Rad23B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90

Rad23B Polyclonal Antibody
ABP52306-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90 Applications tips:
Description: A polyclonal antibody for detection of Rad23B from Human, Mouse, Rat. This Rad23B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90

RAD23B Blocking Peptide
20-abx063176	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RAD23B Rabbit pAb
A1034-100ul	Abclonal	100 ul	EUR 308

RAD23B Rabbit pAb
A1034-200ul	Abclonal	200 ul	EUR 459

RAD23B Rabbit pAb
A1034-20ul	Abclonal	20 ul	EUR 183

RAD23B Rabbit pAb
A1034-50ul	Abclonal	50 ul	EUR 223

RAD23B Polyclonal Antibody
A50444	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RAD23B Mouse mAb
A6842-100ul	Abclonal	100 ul	EUR 308

RAD23B Mouse mAb
A6842-200ul	Abclonal	200 ul	EUR 459

RAD23B Mouse mAb
A6842-20ul	Abclonal	20 ul	Ask for price

RAD23B Mouse mAb
A6842-50ul	Abclonal	50 ul	Ask for price

RAD23B Blocking Peptide
33R-7658	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23B antibody, catalog no. 70R-3309

RAD23B Blocking Peptide
33R-7736	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23B antibody, catalog no. 70R-3307

RAD23B Blocking Peptide
DF4645-BP	Affbiotech	1mg	EUR 195

Anti-RAD23B antibody
PAab07078	Lifescience Market	100 ug	EUR 386

Anti-Rad23B antibody
STJ95327	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Rad23B.

Anti-RAD23B antibody
STJ28924	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-RAD23B antibody
STJ29836	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-RAD23B antibody
STJ11100876	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Rat RAD23B shRNA Plasmid
20-abx988897	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAD23B ELISA KIT
ELI-14942h	Lifescience Market	96 Tests	EUR 824

RAD23B ELISA KIT|Human
EF002284	Lifescience Market	96 Tests	EUR 689

Bovine RAD23B ELISA KIT
ELI-30111b	Lifescience Market	96 Tests	EUR 928

Mouse Rad23b ELISA KIT
ELI-41103m	Lifescience Market	96 Tests	EUR 865

Human RAD23B shRNA Plasmid
20-abx953976	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RAD23B shRNA Plasmid
20-abx972362	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAD23B Antibody, HRP conjugated
1-CSB-PA019260LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAD23B Antibody, FITC conjugated
1-CSB-PA019260LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAD23B Antibody, Biotin conjugated
1-CSB-PA019260LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAD23B Recombinant Protein (Human)
RP025633	ABM	100 ug	Ask for price

RAD23B Recombinant Protein (Rat)
RP223469	ABM	100 ug	Ask for price

RAD23B Recombinant Protein (Mouse)
RP166484	ABM	100 ug	Ask for price

RAD23 Homolog B (RAD23B) Antibody
20-abx174329	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

RAD23 Homolog B (RAD23B) Antibody
20-abx178211	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

RAD23 Homolog B (RAD23B) Antibody
20-abx329464	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

RAD23B Polyclonal Antibody, HRP Conjugated
A50445	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RAD23B Polyclonal Antibody, FITC Conjugated
A50446	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RAD23B Polyclonal Antibody, Biotin Conjugated
A50447	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

[KO Validated] RAD23B Rabbit pAb
A20000-100ul	Abclonal	100 ul	EUR 410

[KO Validated] RAD23B Rabbit pAb
A20000-200ul	Abclonal	200 ul	EUR 571

[KO Validated] RAD23B Rabbit pAb
A20000-20ul	Abclonal	20 ul	EUR 221

[KO Validated] RAD23B Rabbit pAb
A20000-50ul	Abclonal	50 ul	EUR 287

RAD23B ORF Vector (Human) (pORF)
ORF008545	ABM	1.0 ug DNA	EUR 95

Rad23b ORF Vector (Rat) (pORF)
ORF074491	ABM	1.0 ug DNA	EUR 506

Rad23b ORF Vector (Mouse) (pORF)
ORF055496	ABM	1.0 ug DNA	EUR 506

RAD23B ELISA Kit (Human) (OKCD09434)
OKCD09434	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL

RAD23B ELISA Kit (Human) (OKDD00498)
OKDD00498	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

RAD23B ELISA Kit (Mouse) (OKCA01793)
OKCA01793	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Multiubiquitin chain receptor involved in modulation of proteasomal degradation. Binds to polyubiquitin chains. Proposed to be capable to bind simultaneously to the 26S proteasome and to polyubiquitinated substrates and to deliver ubiquitinated proteins to the proteasome. May play a role in endoplasmic reticulum-associated degradation (ERAD) of misfolded glycoproteins by association with PNGase and delivering deglycosylated proteins to the proteasome.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL

Human RAD23 Homolog B (RAD23B) Protein
20-abx654903	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

RAD23B sgRNA CRISPR Lentivector set (Human)
K1778901	ABM	3 x 1.0 ug	EUR 339

Rad23b sgRNA CRISPR Lentivector set (Mouse)
K4597701	ABM	3 x 1.0 ug	EUR 339

Rad23b sgRNA CRISPR Lentivector set (Rat)
K7444601	ABM	3 x 1.0 ug	EUR 339

Human RAD23 Homolog B (RAD23B) CLIA Kit
20-abx496136	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human RAD23 Homolog B (RAD23B) ELISA Kit
20-abx152915	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

RAD23B sgRNA CRISPR Lentivector (Human) (Target 1)
K1778902	ABM	1.0 ug DNA	EUR 154