Human RAD23 Homolog B (RAD23B) ELISA Kit

DLR-RAD23B-Hu-96T 96T
EUR 725
  • Should the Human RAD23 Homolog B (RAD23B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAD23 Homolog B (RAD23B) in samples from tissue homogenates or other biological fluids.

Human RAD23 Homolog B (RAD23B) ELISA Kit

RDR-RAD23B-Hu-48Tests 48 Tests
EUR 589

Human RAD23 Homolog B (RAD23B) ELISA Kit

RDR-RAD23B-Hu-96Tests 96 Tests
EUR 820

Human RAD23 Homolog B (RAD23B) ELISA Kit

RD-RAD23B-Hu-48Tests 48 Tests
EUR 563

Human RAD23 Homolog B (RAD23B) ELISA Kit

RD-RAD23B-Hu-96Tests 96 Tests
EUR 783

Rad23b/ Rat Rad23b ELISA Kit

ELI-44358r 96 Tests
EUR 886

RAD23B antibody

70R-19746 50 ul
EUR 435
Description: Rabbit polyclonal RAD23B antibody

RAD23B Antibody

47184-100ul 100ul
EUR 252

RAD23B Antibody

35170-100ul 100ul
EUR 252

RAD23B Antibody

35170-50ul 50ul
EUR 187

RAD23B antibody

10R-1627 100 ug
EUR 512
Description: Mouse monoclonal RAD23B antibody

RAD23B Antibody

1-CSB-PA003914
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

RAD23B Antibody

DF4645 200ul
EUR 304
Description: RAD23B Antibody detects endogenous levels of total RAD23B.

RAD23B antibody

70R-50301 100 ul
EUR 244
Description: Purified Polyclonal RAD23B antibody

RAD23B antibody

70R-3307 50 ug
EUR 467
Description: Rabbit polyclonal RAD23B antibody

RAD23B antibody

70R-3309 50 ug
EUR 467
Description: Rabbit polyclonal RAD23B antibody

RAD23B Antibody

1-CSB-PA019260GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAD23B Antibody

1-CSB-PA019260LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAD23B siRNA

20-abx904448
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD23B siRNA

20-abx930767
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD23B siRNA

20-abx930768
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD23B Antibody

ABD4645 100 ug
EUR 438

RAD23B Rabbit pAb

A1034-100ul 100 ul
EUR 308

RAD23B Rabbit pAb

A1034-200ul 200 ul
EUR 459

RAD23B Rabbit pAb

A1034-20ul 20 ul
EUR 183

RAD23B Rabbit pAb

A1034-50ul 50 ul
EUR 223

RAD23B Blocking Peptide

33R-7658 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23B antibody, catalog no. 70R-3309

RAD23B Blocking Peptide

33R-7736 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23B antibody, catalog no. 70R-3307

RAD23B Blocking Peptide

DF4645-BP 1mg
EUR 195

RAD23B Blocking Peptide

20-abx063176
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAD23B Conjugated Antibody

C35170 100ul
EUR 397

RAD23B Conjugated Antibody

C47184 100ul
EUR 397

RAD23B cloning plasmid

CSB-CL019260HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1230
  • Sequence: atgcaggtcaccctgaagaccctccagcagcagaccttcaagatagacattgaccccgaggagacggtgaaagcactgaaagagaagattgaatctgaaaaggggaaagatgcctttccagtagcaggtcaaaaattaatttatgcaggcaaaatcctcaatgatgatactgctc
  • Show more
Description: A cloning plasmid for the RAD23B gene.

Rad23B Polyclonal Antibody

ABP52306-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23B from Human, Mouse, Rat. This Rad23B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90

Rad23B Polyclonal Antibody

ABP52306-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23B from Human, Mouse, Rat. This Rad23B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90

Rad23B Polyclonal Antibody

ABP52306-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23B from Human, Mouse, Rat. This Rad23B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Rad23B at AA range: 10-90

RAD23B Mouse mAb

A6842-100ul 100 ul
EUR 308

RAD23B Mouse mAb

A6842-200ul 200 ul
EUR 459

RAD23B Mouse mAb

A6842-20ul 20 ul Ask for price

RAD23B Mouse mAb

A6842-50ul 50 ul Ask for price

RAD23B Polyclonal Antibody

A50444 100 µg
EUR 570.55
Description: Ask the seller for details

anti- RAD23B antibody

FNab07078 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: RAD23 homolog B (S. cerevisiae)
  • Uniprot ID: P54727
  • Gene ID: 5887
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against RAD23B

Rad23B Polyclonal Antibody

ES3305-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Rad23B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Rad23B Polyclonal Antibody

ES3305-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Rad23B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-RAD23B antibody

PAab07078 100 ug
EUR 386

Anti-RAD23B antibody

STJ11100876 100 µl
EUR 413
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-RAD23B antibody

STJ28924 100 µl
EUR 277
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-RAD23B antibody

STJ29836 100 µl
EUR 277
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-Rad23B antibody

STJ95327 200 µl
EUR 197
Description: Rabbit polyclonal to Rad23B.

Human RAD23B ELISA KIT

ELI-14942h 96 Tests
EUR 824

Bovine RAD23B ELISA KIT

ELI-30111b 96 Tests
EUR 928

RAD23B ELISA KIT|Human

EF002284 96 Tests
EUR 689

Rat RAD23B shRNA Plasmid

20-abx988897
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAD23B shRNA Plasmid

20-abx972362
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAD23B Antibody, HRP conjugated

1-CSB-PA019260LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAD23B Antibody, FITC conjugated

1-CSB-PA019260LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAD23B Antibody, Biotin conjugated

1-CSB-PA019260LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23B. Recognizes RAD23B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RAD23B shRNA Plasmid

20-abx953976
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Rad23b ELISA KIT

ELI-41103m 96 Tests
EUR 865

RAD23B Recombinant Protein (Human)

RP025633 100 ug Ask for price

RAD23B Recombinant Protein (Mouse)

RP166484 100 ug Ask for price

RAD23B Recombinant Protein (Rat)

RP223469 100 ug Ask for price

RAD23 Homolog B (RAD23B) Antibody

20-abx178211
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

RAD23 Homolog B (RAD23B) Antibody

20-abx174329
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

RAD23 Homolog B (RAD23B) Antibody

20-abx329464
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAD23B Polyclonal Antibody, HRP Conjugated

A50445 100 µg
EUR 570.55
Description: The best epigenetics products

RAD23B Polyclonal Antibody, FITC Conjugated

A50446 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAD23B Polyclonal Antibody, Biotin Conjugated

A50447 100 µg
EUR 570.55
Description: fast delivery possible

[KO Validated] RAD23B Rabbit pAb

A20000-100ul 100 ul
EUR 410

[KO Validated] RAD23B Rabbit pAb

A20000-200ul 200 ul
EUR 571

[KO Validated] RAD23B Rabbit pAb

A20000-20ul 20 ul
EUR 221

[KO Validated] RAD23B Rabbit pAb

A20000-50ul 50 ul
EUR 287

Rad23b ORF Vector (Rat) (pORF)

ORF074491 1.0 ug DNA
EUR 506

RAD23B ORF Vector (Human) (pORF)

ORF008545 1.0 ug DNA
EUR 95

Rad23b ORF Vector (Mouse) (pORF)

ORF055496 1.0 ug DNA
EUR 506

RAD23B ELISA Kit (Mouse) (OKCA01793)

OKCA01793 96 Wells
EUR 846
Description: Description of target: Multiubiquitin chain receptor involved in modulation of proteasomal degradation. Binds to polyubiquitin chains. Proposed to be capable to bind simultaneously to the 26S proteasome and to polyubiquitinated substrates and to deliver ubiquitinated proteins to the proteasome. May play a role in endoplasmic reticulum-associated degradation (ERAD) of misfolded glycoproteins by association with PNGase and delivering deglycosylated proteins to the proteasome.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL

RAD23B ELISA Kit (Human) (OKCD09434)

OKCD09434 96 Wells
EUR 909
Description: Description of target: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL

RAD23B ELISA Kit (Human) (OKDD00498)

OKDD00498 96 Wells
EUR 1053
Description: Description of target: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

Human RAD23 Homolog B (RAD23B) Protein

20-abx654903
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rad23b sgRNA CRISPR Lentivector set (Rat)

K7444601 3 x 1.0 ug
EUR 339

RAD23B sgRNA CRISPR Lentivector set (Human)

K1778901 3 x 1.0 ug
EUR 339

Rad23b sgRNA CRISPR Lentivector set (Mouse)

K4597701 3 x 1.0 ug
EUR 339

Human RAD23 Homolog B (RAD23B) ELISA Kit

20-abx152915
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAD23 Homolog B (RAD23B) CLIA Kit

20-abx496136
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rad23b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7444602 1.0 ug DNA
EUR 154