Beopenlab

RAB22A Antibody
36733-100ul	SAB	100ul	EUR 252

RAB22A Antibody
DF9820	Affbiotech	200ul	EUR 304
Description: RAB22A Antibody detects endogenous levels of total RAB22A.

RAB22A Antibody
1-CSB-PA265650	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB22A. Recognizes RAB22A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB22A Antibody
1-CSB-PA171022	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB22A. Recognizes RAB22A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

RAB22A antibody
70R-4379	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAB22A antibody raised against the middle region of RAB22A

RAB22A Antibody
1-CSB-PA019172GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB22A. Recognizes RAB22A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB22A siRNA
20-abx930619	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB22A siRNA
20-abx930620	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB22A Antibody
ABD9820	Lifescience Market	100 ug	EUR 438

anti-RAB22A
YF-PA20176	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to RAB22A

anti-RAB22A
YF-PA20177	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RAB22A

anti-RAB22A
YF-PA20178	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to RAB22A

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody
20-abx212305	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody
20-abx212352	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Rab22A, Member Ras Oncogene Family (RAB22A) Antibody
20-abx114970	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody
20-abx123533	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody
abx030618-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody
abx030618-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody
abx237004-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RAB22A Rabbit pAb
A15485-100ul	Abclonal	100 ul	EUR 308

RAB22A Rabbit pAb
A15485-200ul	Abclonal	200 ul	EUR 459

RAB22A Rabbit pAb
A15485-20ul	Abclonal	20 ul	EUR 183

RAB22A Rabbit pAb
A15485-50ul	Abclonal	50 ul	EUR 223

RAB22A Blocking Peptide
33R-3964	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB22A antibody, catalog no. 70R-4379

RAB22A cloning plasmid
CSB-CL891957HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 585 Sequence: atggcgctgagggagctcaaagtgtgtctgctcggggatacaggtgtaggtaaatcgagtattgtgtggcggtttgtggaagacagttttgatccaaacatcaacccaacaataggggcatcttttatgaccaagactgtccagtaccaaaatgagctacataaattcctaatctg Show more
Description: A cloning plasmid for the RAB22A gene.

RAB22A Blocking Peptide
DF9820-BP	Affbiotech	1mg	EUR 195

RAB22A Conjugated Antibody
C36733	SAB	100ul	EUR 397

RAB22A-specific Antibody
abx237005-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

RAB22A Rabbit pAb
A3685-100ul	Abclonal	100 ul	EUR 308

RAB22A Rabbit pAb
A3685-200ul	Abclonal	200 ul	EUR 459

RAB22A Rabbit pAb
A3685-20ul	Abclonal	20 ul	Ask for price

RAB22A Rabbit pAb
A3685-50ul	Abclonal	50 ul	Ask for price

anti- RAB22A antibody
FNab07004	FN Test	100µg	EUR 548.75
Immunogen: RAB22A, member RAS oncogene family Uniprot ID: Q9UL26 Gene ID: 57403 Research Area: Signal Transduction
Description: Antibody raised against RAB22A

Anti-RAB22A antibody
PAab07004	Lifescience Market	100 ug	EUR 386

Anti-RAB22A antibody
STJ26446	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments.

Anti-RAB22A antibody
STJ117680	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments.

Anti-RAB22A (2B12)
YF-MA19047	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RAB22A

RAB22A protein (His tag)
80R-1966	Fitzgerald	10 ug	EUR 322
Description: Recombinant human RAB22A protein (His tag)

Canine RAB22A ELISA KIT
ELI-18282d	Lifescience Market	96 Tests	EUR 928

RAB22A ELISA KIT|Human
EF002223	Lifescience Market	96 Tests	EUR 689

Mouse RAB22A shRNA Plasmid
20-abx972341	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAB22A shRNA Plasmid
20-abx961429	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- RAB22A-specific antibody
FNab07005	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 Immunogen: RAB22A, member RAS oncogene family Uniprot ID: Q9UL26 Research Area: Signal Transduction
Description: Antibody raised against RAB22A-specific

Anti-RAB22A-specific antibody
PAab07005	Lifescience Market	100 ug	EUR 412

RAB22A Recombinant Protein (Human)
RP025441	ABM	100 ug	Ask for price

RAB22A Recombinant Protein (Mouse)
RP166223	ABM	100 ug	Ask for price

RAB22A Recombinant Protein (Rat)
RP223274	ABM	100 ug	Ask for price

Polyclonal RAB22A Antibody (C-term)
AMM07440G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB22A (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RAB22A antibody - middle region
AMM07441G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB22A - middle region. This antibody is tested and proven to work in the following applications:

Rab22a ORF Vector (Rat) (pORF)
ORF074426	ABM	1.0 ug DNA	EUR 506

RAB22A ORF Vector (Human) (pORF)
ORF008481	ABM	1.0 ug DNA	EUR 95

Rab22a ORF Vector (Mouse) (pORF)
ORF055409	ABM	1.0 ug DNA	EUR 506

Rab22a sgRNA CRISPR Lentivector set (Rat)
K6601501	ABM	3 x 1.0 ug	EUR 339

Rab22a sgRNA CRISPR Lentivector set (Mouse)
K4520101	ABM	3 x 1.0 ug	EUR 339

RAB22A sgRNA CRISPR Lentivector set (Human)
K1772501	ABM	3 x 1.0 ug	EUR 339

Rab22a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6601502	ABM	1.0 ug DNA	EUR 154

Rab22a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6601503	ABM	1.0 ug DNA	EUR 154

Rab22a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6601504	ABM	1.0 ug DNA	EUR 154

Rab22a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4520102	ABM	1.0 ug DNA	EUR 154

Rab22a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4520103	ABM	1.0 ug DNA	EUR 154

Rab22a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4520104	ABM	1.0 ug DNA	EUR 154

RAB22A sgRNA CRISPR Lentivector (Human) (Target 1)
K1772502	ABM	1.0 ug DNA	EUR 154

RAB22A sgRNA CRISPR Lentivector (Human) (Target 2)
K1772503	ABM	1.0 ug DNA	EUR 154

RAB22A sgRNA CRISPR Lentivector (Human) (Target 3)
K1772504	ABM	1.0 ug DNA	EUR 154

RAB22A Protein Vector (Rat) (pPB-C-His)
PV297702	ABM	500 ng	EUR 603

RAB22A Protein Vector (Rat) (pPB-N-His)
PV297703	ABM	500 ng	EUR 603

RAB22A Protein Vector (Rat) (pPM-C-HA)
PV297704	ABM	500 ng	EUR 603

RAB22A Protein Vector (Rat) (pPM-C-His)
PV297705	ABM	500 ng	EUR 603

RAB22A Protein Vector (Human) (pPB-C-His)
PV033921	ABM	500 ng	EUR 329

RAB22A Protein Vector (Human) (pPB-N-His)
PV033922	ABM	500 ng	EUR 329

RAB22A Protein Vector (Human) (pPM-C-HA)
PV033923	ABM	500 ng	EUR 329

RAB22A Protein Vector (Human) (pPM-C-His)
PV033924	ABM	500 ng	EUR 329

RAB22A Protein Vector (Mouse) (pPB-C-His)
PV221634	ABM	500 ng	EUR 603

RAB22A Protein Vector (Mouse) (pPB-N-His)
PV221635	ABM	500 ng	EUR 603

RAB22A Protein Vector (Mouse) (pPM-C-HA)
PV221636	ABM	500 ng	EUR 603

RAB22A Protein Vector (Mouse) (pPM-C-His)
PV221637	ABM	500 ng	EUR 603

Recombinant Human RAB22A Protein, His, E.coli-1ug
QP13233-1ug	EnQuireBio	1ug	EUR 155

Recombinant Human RAB22A Protein, His, E.coli-50ug
QP13233-50ug	EnQuireBio	50ug	EUR 1261

Recombinant Human RAB22A Protein, His, E.coli-5ug
QP13233-5ug	EnQuireBio	5ug	EUR 201

Rab22a 3'UTR Luciferase Stable Cell Line
TU117399	ABM	1.0 ml	Ask for price

Rab22a 3'UTR GFP Stable Cell Line
TU167399	ABM	1.0 ml	Ask for price

Rab22a 3'UTR Luciferase Stable Cell Line
TU217184	ABM	1.0 ml	Ask for price

Rab22a 3'UTR GFP Stable Cell Line
TU267184	ABM	1.0 ml	Ask for price

RAB22A 3'UTR GFP Stable Cell Line
TU069375	ABM	1.0 ml	EUR 4617

RAB22A 3'UTR Luciferase Stable Cell Line
TU019375	ABM	1.0 ml	EUR 4617