Beopenlab

PHC1 siRNA
20-abx928417	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PHC1 Antibody
33082-100ul	SAB	100ul	EUR 252

PHC1 Antibody
1-CSB-PA017891HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PHC1 Conjugated Antibody
C33082	SAB	100ul	EUR 397

PHC1 cloning plasmid
CSB-CL017891HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1344 Sequence: atgccaggtacagtgcagtctggtcaggcccatttggcctcctcgccaccttcatcccaggctcctggtgcactgcaggagtgccctcccacattggcccctgggatgacccttgctcctgtgcaggggacagcacatgtggtaaagggtggggctaccacctcctcacctgttg Show more
Description: A cloning plasmid for the PHC1 gene.

PHC1 Polyclonal Antibody
A-2731	EpiGentek	100 µl	EUR 483.55
Description: kits suitable for this type of research

PHC1 Rabbit pAb
A5843-100ul	Abclonal	100 ul	EUR 308

PHC1 Rabbit pAb
A5843-200ul	Abclonal	200 ul	EUR 459

PHC1 Rabbit pAb
A5843-20ul	Abclonal	20 ul	EUR 183

PHC1 Rabbit pAb
A5843-50ul	Abclonal	50 ul	EUR 223

Anti-PHC1 antibody
STJ28406	St John's Laboratory	100 µl	EUR 277
Description: This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein.

anti-EDR1 / PHC1
YF-PA11492	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to EDR1 / PHC1

anti-EDR1 / PHC1
YF-PA11493	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to EDR1 / PHC1

anti-EDR1 / PHC1
YF-PA11494	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to EDR1 / PHC1

Human PHC1 shRNA Plasmid
20-abx951330	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PHC1 shRNA Plasmid
20-abx970111	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PHC1 Antibody, HRP conjugated
1-CSB-PA017891HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PHC1 Antibody, FITC conjugated
1-CSB-PA017891HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PHC1 Antibody, Biotin conjugated
1-CSB-PA017891HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHC1. Recognizes PHC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-EDR1 / PHC1 (3G1)
YF-MA12776	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EDR1 / PHC1

Monoclonal PHC1 Antibody, Clone: 1F3F3
APR17840G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human PHC1. The antibodies are raised in Mouse and are from clone 1F3F3. This antibody is applicable in WB, FC, E

Polyclonal PHC1 Antibody (N-Term)
APR17841G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHC1 (N-Term). This antibody is tested and proven to work in the following applications:

PHC1 ORF Vector (Human) (pORF)
ORF007761	ABM	1.0 ug DNA	EUR 95

Phc1 ORF Vector (Rat) (pORF)
ORF073428	ABM	1.0 ug DNA	EUR 506

Phc1 ORF Vector (Mouse) (pORF)
ORF053900	ABM	1.0 ug DNA	EUR 506

Phc1 ORF Vector (Mouse) (pORF)
ORF053901	ABM	1.0 ug DNA	EUR 506

Polyhomeotic-Like Protein 1 (PHC1) Antibody
20-abx141807	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody
20-abx004481	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody
abx015967-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody
20-abx312993	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PHC1 sgRNA CRISPR Lentivector set (Human)
K1638101	ABM	3 x 1.0 ug	EUR 339

Phc1 sgRNA CRISPR Lentivector set (Mouse)
K3723601	ABM	3 x 1.0 ug	EUR 339

Phc1 sgRNA CRISPR Lentivector set (Rat)
K6670901	ABM	3 x 1.0 ug	EUR 339

Monoclonal PHC1 Antibody (monoclonal) (M05), Clone: 3G1
AMM07121G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PHC1 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 3G1. This antibody is applicable in WB, E

Polyhomeotic-Like Protein 1 (PHC1) Antibody (HRP)
20-abx312994	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody (FITC)
20-abx312995	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polyhomeotic-Like Protein 1 (PHC1) Antibody (Biotin)
20-abx312996	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PHC1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1638102	ABM	1.0 ug DNA	EUR 154

PHC1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1638103	ABM	1.0 ug DNA	EUR 154

PHC1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1638104	ABM	1.0 ug DNA	EUR 154

Phc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3723602	ABM	1.0 ug DNA	EUR 154

Phc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3723603	ABM	1.0 ug DNA	EUR 154

Phc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3723604	ABM	1.0 ug DNA	EUR 154

Phc1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6670902	ABM	1.0 ug DNA	EUR 154

Phc1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6670903	ABM	1.0 ug DNA	EUR 154

Phc1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6670904	ABM	1.0 ug DNA	EUR 154

PHC1 Protein Vector (Human) (pPB-C-His)
PV031041	ABM	500 ng	EUR 329

PHC1 Protein Vector (Human) (pPB-N-His)
PV031042	ABM	500 ng	EUR 329

PHC1 Protein Vector (Human) (pPM-C-HA)
PV031043	ABM	500 ng	EUR 329

PHC1 Protein Vector (Human) (pPM-C-His)
PV031044	ABM	500 ng	EUR 329

PHC1 Protein Vector (Mouse) (pPB-C-His)
PV215598	ABM	500 ng	EUR 1065

PHC1 Protein Vector (Mouse) (pPB-N-His)
PV215599	ABM	500 ng	EUR 1065

PHC1 Protein Vector (Mouse) (pPM-C-HA)
PV215600	ABM	500 ng	EUR 1065

PHC1 Protein Vector (Mouse) (pPM-C-His)
PV215601	ABM	500 ng	EUR 1065

PHC1 Protein Vector (Mouse) (pPB-C-His)
PV215602	ABM	500 ng	EUR 1065