Beopenlab

P2RY12 Antibody
31255-50ul	SAB	50ul	EUR 187

P2RY12 Antibody
DF10263	Affbiotech	200ul	EUR 304
Description: P2RY12 Antibody detects endogenous levels of total P2RY12.

P2RY12 antibody
70R-7094	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal P2RY12 antibody raised against the N terminal of P2RY12

P2RY12 Antibody
ABD10263	Lifescience Market	100 ug	EUR 438

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit
DLR-P2RY12-Hu-48T	DL Develop	48T	EUR 517
Should the Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit
DLR-P2RY12-Hu-96T	DL Develop	96T	EUR 673
Should the Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit
RDR-P2RY12-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit
RDR-P2RY12-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit
RD-P2RY12-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit
RD-P2RY12-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

P2ry12/ Rat P2ry12 ELISA Kit
ELI-37646r	Lifescience Market	96 Tests	EUR 886

P2RY12 Conjugated Antibody
C31255	SAB	100ul	EUR 397

Anti-P2RY12 antibody
STJ117783	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene.

P2RY12 siRNA
20-abx903802	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RY12 siRNA
20-abx927541	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RY12 siRNA
20-abx927542	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RY12 Blocking Peptide
33R-9419	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RY12 antibody, catalog no. 70R-7094

P2RY12 Blocking Peptide
DF10263-BP	Affbiotech	1mg	EUR 195

P2RY12 cloning plasmid
CSB-CL861997HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1029 Sequence: atgcaagccgtcgacaatctcacctctgcgcctgggaacaccagtctgtgcaccagagactacaaaatcacccaggtcctcttcccactgctctacactgtcctgttttttgttggacttatcacaaatggcctggcgatgaggattttctttcaaatccggagtaaatcaaact Show more
Description: A cloning plasmid for the P2RY12 gene.

P2RY12 Rabbit pAb
A1710-100ul	Abclonal	100 ul	EUR 308

P2RY12 Rabbit pAb
A1710-200ul	Abclonal	200 ul	EUR 459

P2RY12 Rabbit pAb
A1710-20ul	Abclonal	20 ul	EUR 183

P2RY12 Rabbit pAb
A1710-50ul	Abclonal	50 ul	EUR 223

pcDNA3.1-P2RY12 Plasmid
PVTB00561-2a	Lifescience Market	2 ug	EUR 356

Purinergic Receptor P2Y12 (P2RY12) Antibody
abx217587-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Human P2RY12 ELISA Kit
ELA-E12345h	Lifescience Market	96 Tests	EUR 824

P2RY12 ELISA KIT|Human
EF004691	Lifescience Market	96 Tests	EUR 689

Mouse P2RY12 shRNA Plasmid
20-abx977309	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat P2RY12 shRNA Plasmid
20-abx986343	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human P2RY12 shRNA Plasmid
20-abx962103	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

P2RY12 Recombinant Protein (Human)
RP022357	ABM	100 ug	Ask for price

P2RY12 Recombinant Protein (Mouse)
RP159788	ABM	100 ug	Ask for price

P2RY12 Recombinant Protein (Rat)
RP219074	ABM	100 ug	Ask for price

Polyclonal P2RY12 / P2Y12 Antibody (Extracellular Domain)
APR12672G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY12 / P2Y12 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal P2RY12 / P2Y12 Antibody (N-Terminus)
APR12673G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY12 / P2Y12 (N-Terminus). This antibody is tested and proven to work in the following applications:

Human P2Y purinoceptor 12 (P2RY12)
1-CSB-CF861997HU	Cusabio	EUR 1309.00 EUR 583.00 EUR 839.00	1MG 200ug 500ug
MW: 42.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human P2Y purinoceptor 12(P2RY12) expressed in in vitro E.coli expression system

P2ry12 ORF Vector (Rat) (pORF)
ORF073026	ABM	1.0 ug DNA	EUR 506

P2RY12 ORF Vector (Human) (pORF)
ORF007453	ABM	1.0 ug DNA	EUR 95

P2ry12 ORF Vector (Mouse) (pORF)
ORF053264	ABM	1.0 ug DNA	EUR 506

P2RY12 ELISA Kit (Human) (OKAN05743)
OKAN05743	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

P2RY12 ELISA Kit (Human) (OKCD08892)
OKCD08892	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

P2RY12 ELISA Kit (Mouse) (OKEH05603)
OKEH05603	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Receptor for ADP and ATP coupled to G-proteins that inhibit the adenylyl cyclase second messenger system. Required for normal platelet aggregation and blood coagulation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

P2RY12 ELISA Kit (Rat) (OKEH06201)
OKEH06201	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Receptor for ADP and ATP coupled to G-proteins that inhibit the adenylyl cyclase second messenger system. Required for normal platelet aggregation and blood coagulation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

P2RY12 ELISA Kit (Rat) (OKEH06696)
OKEH06696	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Receptor for ADP and ATP coupled to G-proteins that inhibit the adenylyl cyclase second messenger system. Required for normal platelet aggregation and blood coagulation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL

P2ry12 sgRNA CRISPR Lentivector set (Rat)
K7066901	ABM	3 x 1.0 ug	EUR 339

P2ry12 sgRNA CRISPR Lentivector set (Mouse)
K3909901	ABM	3 x 1.0 ug	EUR 339

P2RY12 sgRNA CRISPR Lentivector set (Human)
K1583001	ABM	3 x 1.0 ug	EUR 339

Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) Antibody
20-abx178194	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) Antibody
20-abx174311	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human Purinergic Receptor P2Y12 (P2RY12) ELISA Kit
abx250686-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat P2ry12/ P2Y purinoceptor 12 ELISA Kit
E0721Ra	Sunlong	1 Kit	EUR 646

Mouse P2ry12/ P2Y purinoceptor 12 ELISA Kit
E1091Mo	Sunlong	1 Kit	EUR 632

Human P2RY12/ P2Y purinoceptor 12 ELISA Kit
E1851Hu	Sunlong	1 Kit	EUR 605

Human P2RY12(P2Y purinoceptor 12) ELISA Kit
EH1410	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9H244 Alias: P2RY12/P2Y purinoceptor 12/P2Y12/P2Y12 platelet ADP receptor/ADP-glucose receptor/ADPG-R
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human P2Y purinoceptor 12, P2RY12 ELISA KIT
ELI-14697h	Lifescience Market	96 Tests	EUR 824