Beopenlab

NUP155 siRNA
20-abx903704	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP155 Antibody
ABD9708	Lifescience Market	100 ug	EUR 438

NUP155 siRNA
20-abx926619	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP155 siRNA
20-abx926620	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP155 antibody
70R-2127	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NUP155 antibody raised against the middle region of NUP155

NUP155 antibody
70R-3056	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NUP155 antibody raised against the N terminal of NUP155

NUP155 antibody
70R-9235	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal NUP155 antibody

NUP155 Antibody
24722-100ul	SAB	100ul	EUR 390

NUP155 Antibody
DF9708	Affbiotech	200ul	EUR 304
Description: NUP155 Antibody detects endogenous levels of total NUP155.

NUP155 Antibody
1-CSB-PA016191ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NUP155. Recognizes NUP155 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Polyclonal NUP155 Antibody
APR17647G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP155 . This antibody is tested and proven to work in the following applications:

NUP155 cloning plasmid
CSB-CL016191HU-10ug	Cusabio	10ug	EUR 1780
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4176 Sequence: atgccgtcttctttgttgggcgcggcgatgccggcctctacatctgccgcagccctgcaggaagctctggaaaatgctggacggctcatcgaccgtcagttgcaagaggaccgcatgtacccggacctttccgagctgcttatggtgtctgccccaaataatcccaccgtttctg Show more
Description: A cloning plasmid for the NUP155 gene.

NUP155 Rabbit pAb
A7764-100ul	Abclonal	100 ul	EUR 308

NUP155 Rabbit pAb
A7764-200ul	Abclonal	200 ul	EUR 459

NUP155 Rabbit pAb
A7764-20ul	Abclonal	20 ul	EUR 183

NUP155 Rabbit pAb
A7764-50ul	Abclonal	50 ul	EUR 223

NUP155 Blocking Peptide
33R-4155	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP155 antibody, catalog no. 70R-2127

NUP155 Blocking Peptide
33R-6308	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP155 antibody, catalog no. 70R-3056

NUP155 Blocking Peptide
33R-1659	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP155 antibody, catalog no. 70R-9235

NUP155 Polyclonal Antibody
31321-100ul	SAB	100ul	EUR 252

NUP155 Polyclonal Antibody
31321-50ul	SAB	50ul	EUR 187

NUP155 Blocking Peptide
DF9708-BP	Affbiotech	1mg	EUR 195

Anti-NUP155 antibody
STJ110075	St John's Laboratory	100 µl	EUR 277
Description: Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6.

Human Nuclear pore complex protein Nup155, NUP155 ELISA KIT
ELI-15040h	Lifescience Market	96 Tests	EUR 824

Mouse Nuclear pore complex protein Nup155, Nup155 ELISA KIT
ELI-44221m	Lifescience Market	96 Tests	EUR 865

NUP155 Polyclonal Conjugated Antibody
C31321	SAB	100ul	EUR 397

Mouse NUP155 shRNA Plasmid
20-abx980338	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NUP155 shRNA Plasmid
20-abx987372	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NUP155 ELISA Kit
EHN0058	Abclonal	96Tests	EUR 521

Goat NUP155 ELISA Kit
EGTN0058	Abclonal	96Tests	EUR 521

Bovine NUP155 ELISA Kit
EBN0058	Abclonal	96Tests	EUR 521

Canine NUP155 ELISA Kit
ECN0058	Abclonal	96Tests	EUR 521

Anserine NUP155 ELISA Kit
EAN0058	Abclonal	96Tests	EUR 521

Porcine NUP155 ELISA Kit
EPN0058	Abclonal	96Tests	EUR 521

Rat NUP155 ELISA Kit
ERN0058	Abclonal	96Tests	EUR 521

Rabbit NUP155 ELISA Kit
ERTN0058	Abclonal	96Tests	EUR 521

Mouse NUP155 ELISA Kit
EMN0058	Abclonal	96Tests	EUR 521

Nucleoporin 155 (NUP155) Antibody
20-abx142111	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 155 (NUP155) Antibody
20-abx007057	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 155 (NUP155) Antibody
20-abx321949	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Human NUP155 shRNA Plasmid
20-abx956410	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Nucleoporin 155kDa (NUP155)
4-RPB157Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O75694 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.7kDa Isoelectric Point: 6.1
Description: Recombinant Human Nucleoporin 155kDa expressed in: E.coli

Guinea Pig NUP155 ELISA Kit
EGN0058	Abclonal	96Tests	EUR 521

Nucleoporin 155 kDa (NUP155) Antibody
20-abx131357	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

NUP155 ORF Vector (Human) (pORF)
ORF007302	ABM	1.0 ug DNA	EUR 95

Nup155 ORF Vector (Rat) (pORF)
ORF071614	ABM	1.0 ug DNA	EUR 2080

Nup155 ORF Vector (Mouse) (pORF)
ORF051823	ABM	1.0 ug DNA	EUR 1572

NUP155 ELISA Kit (Human) (OKEI00217)
OKEI00217	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Essential component of nuclear pore complex. Could be essessential for embryogenesis. Nucleoporins may be involved both in binding and translocating proteins during nucleocytoplasmic transport.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

NUP155 ELISA Kit (Mouse) (OKEI00493)
OKEI00493	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Essential component of nuclear pore complex. Could be essessential for embryogenesis. Nucleoporins may be involved both in binding and translocating proteins during nucleocytoplasmic transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

NUP155 ELISA Kit (Rat) (OKEI00798)
OKEI00798	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Essential component of nuclear pore complex. Could be essessential for embryogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human Nucleoporin 155 kDa (NUP155) Protein
20-abx168258	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

NUP155 sgRNA CRISPR Lentivector set (Human)
K1469101	ABM	3 x 1.0 ug	EUR 339

Nup155 sgRNA CRISPR Lentivector set (Mouse)
K4585601	ABM	3 x 1.0 ug	EUR 339

Nup155 sgRNA CRISPR Lentivector set (Rat)
K7124601	ABM	3 x 1.0 ug	EUR 339

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human)
4-PAB157Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155)

Human Nucleoporin 155kDa(NUP155)ELISA Kit
QY-E05261	Qayee Biotechnology	96T	EUR 400

Pig Nucleoporin 155 kDa (NUP155) ELISA Kit
abx361056-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Nucleoporin 155 kDa (NUP155) ELISA Kit
abx363223-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Nucleoporin 155 kDa (NUP155) ELISA Kit
abx364030-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

ELISA kit for Mouse NUP155 (Nucleoporin 155kDa)
E-EL-M0849	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's NUP155 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP155. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse NUP155 (Nucleoporin 155kDa) in samples from Serum, Plasma, Cell supernatant

Mouse Nucleoporin 155 kDa (NUP155) ELISA Kit
abx352910-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Nucleoporin 155 kDa (NUP155) ELISA Kit
abx353806-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Nucleoporin 155 kDa (NUP155) ELISA Kit
abx354441-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Chicken Nucleoporin 155 kDa (NUP155) ELISA Kit
abx356689-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Nucleoporin 155 kDa (NUP155) ELISA Kit
abx359130-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

NUP155 sgRNA CRISPR Lentivector (Human) (Target 1)
K1469102	ABM	1.0 ug DNA	EUR 154

NUP155 sgRNA CRISPR Lentivector (Human) (Target 2)
K1469103	ABM	1.0 ug DNA	EUR 154

NUP155 sgRNA CRISPR Lentivector (Human) (Target 3)
K1469104	ABM	1.0 ug DNA	EUR 154

Nup155 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4585602	ABM	1.0 ug DNA	EUR 154

Nup155 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4585603	ABM	1.0 ug DNA	EUR 154

Nup155 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4585604	ABM	1.0 ug DNA	EUR 154

ELISA kit for Rat NUP155 (Nucleoporin 155kDa)
E-EL-R0679	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's NUP155 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat NUP155. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat NUP155 (Nucleoporin 155kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NUP155 (Nucleoporin 155kDa)
E-EL-H1368	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's NUP155 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NUP155. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NUP155 (Nucleoporin 155kDa) in samples from Serum, Plasma, Cell supernatant

Nup155 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7124602	ABM	1.0 ug DNA	EUR 154

Nup155 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7124603	ABM	1.0 ug DNA	EUR 154

Nup155 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7124604	ABM	1.0 ug DNA	EUR 154

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), APC
4-PAB157Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with APC.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), Biotinylated
4-PAB157Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with Biotin.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), Cy3
4-PAB157Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with Cy3.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), FITC
4-PAB157Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with FITC.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), HRP
4-PAB157Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with HRP.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), PE
4-PAB157Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP155 (Gln1154~Asn1379) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with PE.

NUP155 Protein Vector (Human) (pPB-C-His)
PV029205	ABM	500 ng	EUR 329

NUP155 Protein Vector (Human) (pPB-N-His)
PV029206	ABM	500 ng	EUR 329

NUP155 Protein Vector (Human) (pPM-C-HA)
PV029207	ABM	500 ng	EUR 329

NUP155 Protein Vector (Human) (pPM-C-His)
PV029208	ABM	500 ng	EUR 329

NUP155 Protein Vector (Mouse) (pPB-C-His)
PV207290	ABM	500 ng	EUR 2372

NUP155 Protein Vector (Mouse) (pPB-N-His)
PV207291	ABM	500 ng	EUR 2372

NUP155 Protein Vector (Mouse) (pPM-C-HA)
PV207292	ABM	500 ng	EUR 2372

NUP155 Protein Vector (Mouse) (pPM-C-His)
PV207293	ABM	500 ng	EUR 2372

NUP155 Protein Vector (Rat) (pPB-C-His)
PV286454	ABM	500 ng	EUR 2370

NUP155 Protein Vector (Rat) (pPB-N-His)
PV286455	ABM	500 ng	EUR 2370

NUP155 Protein Vector (Rat) (pPM-C-HA)
PV286456	ABM	500 ng	EUR 2370

NUP155 Protein Vector (Rat) (pPM-C-His)
PV286457	ABM	500 ng	EUR 2370

Nup155 3'UTR GFP Stable Cell Line
TU164432	ABM	1.0 ml	Ask for price