MLEC siRNA

20-abx903276
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MLEC siRNA

20-abx924228
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MLEC siRNA

20-abx924229
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-MLEC

PVT18389 2 ug
EUR 231

Malectin (MLEC) Antibody

20-abx100273
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Malectin (MLEC) Protein

20-abx262673
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

MLEC cloning plasmid

CSB-CL014620HU-10ug 10ug
EUR 356
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atgctgggagcctgggcggttgagggaaccgctgtggcgctcctgcgactgctgctgctgctgctgccgccggcgatccggggacccgggctcggcgtggccggcgtggccggcgcggcgggggccgggctgcccgagagcgtcatttgggcggtcaacgcgggtggagaggcgca
  • Show more
Description: A cloning plasmid for the MLEC gene.

Recombinant Malectin (MLEC)

4-RPM908Ga01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q98TA4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Chicken Malectin expressed in: E.coli

MLEC protein (His tag)

80R-2934 50 ug
EUR 435
Description: Purified recombinant LIMD2 protein (His tag)

Chicken Malectin (MLEC) Protein

20-abx067920
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat MLEC shRNA Plasmid

20-abx989275
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Malectin (MLEC) Antibody (Biotin)

20-abx271704
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Malectin (MLEC) Antibody (FITC)

20-abx273549
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human MLEC shRNA Plasmid

20-abx956526
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MLEC shRNA Plasmid

20-abx979976
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MLEC Recombinant Protein (Human)

RP019552 100 ug Ask for price

MLEC Recombinant Protein (Mouse)

RP150794 100 ug Ask for price

MLEC Recombinant Protein (Rat)

RP211850 100 ug Ask for price

Mouse Malectin, Mlec ELISA KIT

ELI-16534m 96 Tests
EUR 865

Human Malectin, MLEC ELISA KIT

ELI-19494h 96 Tests
EUR 824

Mlec ORF Vector (Rat) (pORF)

ORF070618 1.0 ug DNA
EUR 506

MLEC ORF Vector (Human) (pORF)

ORF006518 1.0 ug DNA
EUR 95

Mlec ORF Vector (Mouse) (pORF)

ORF050266 1.0 ug DNA
EUR 506

MLEC Malectin Human Recombinant Protein

PROTQ14165 Regular: 10ug
EUR 317
Description: MLEC Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 264 amino acids (29-269) and having a molecular mass of 29.1kDa.

Malectin (MLEC) Polyclonal Antibody (Chicken)

4-PAM908Ga01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC)

Human Malectin(MLEC)ELISA Kit

QY-E04811 96T
EUR 361

ELISA kit for Rat Malectin (MLEC)

KTE100609-48T 48T
EUR 332
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Malectin (MLEC)

KTE100609-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Malectin (MLEC)

KTE100609-96T 96T
EUR 539
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mlec sgRNA CRISPR Lentivector set (Rat)

K7294101 3 x 1.0 ug
EUR 339

MLEC sgRNA CRISPR Lentivector set (Human)

K1307201 3 x 1.0 ug
EUR 339

Mlec sgRNA CRISPR Lentivector set (Mouse)

K4531201 3 x 1.0 ug
EUR 339

ELISA kit for Mouse Malectin (MLEC)

KTE71013-48T 48T
EUR 332
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Malectin (MLEC)

KTE71013-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Malectin (MLEC)

KTE71013-96T 96T
EUR 539
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malectin (MLEC)

KTE61601-48T 48T
EUR 332
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. Malectin has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic ret
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malectin (MLEC)

KTE61601-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. Malectin has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic ret
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malectin (MLEC)

KTE61601-96T 96T
EUR 539
  • MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. Malectin has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic ret
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Malectin (MLEC) Polyclonal Antibody (Chicken), APC

4-PAM908Ga01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with APC.

Malectin (MLEC) Polyclonal Antibody (Chicken), Biotinylated

4-PAM908Ga01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with Biotin.

Malectin (MLEC) Polyclonal Antibody (Chicken), Cy3

4-PAM908Ga01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with Cy3.

Malectin (MLEC) Polyclonal Antibody (Chicken), FITC

4-PAM908Ga01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with FITC.

Malectin (MLEC) Polyclonal Antibody (Chicken), HRP

4-PAM908Ga01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with HRP.

Malectin (MLEC) Polyclonal Antibody (Chicken), PE

4-PAM908Ga01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with PE.

Mlec sgRNA CRISPR Lentivector (Rat) (Target 1)

K7294102 1.0 ug DNA
EUR 154

Mlec sgRNA CRISPR Lentivector (Rat) (Target 2)

K7294103 1.0 ug DNA
EUR 154

Mlec sgRNA CRISPR Lentivector (Rat) (Target 3)

K7294104 1.0 ug DNA
EUR 154

MLEC sgRNA CRISPR Lentivector (Human) (Target 1)

K1307202 1.0 ug DNA
EUR 154

MLEC sgRNA CRISPR Lentivector (Human) (Target 2)

K1307203 1.0 ug DNA
EUR 154

MLEC sgRNA CRISPR Lentivector (Human) (Target 3)

K1307204 1.0 ug DNA
EUR 154

Mlec sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4531202 1.0 ug DNA
EUR 154

Mlec sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4531203 1.0 ug DNA
EUR 154

Mlec sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4531204 1.0 ug DNA
EUR 154

Malectin (MLEC) Polyclonal Antibody (Chicken), APC-Cy7

4-PAM908Ga01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MLEC (Leu22~Leu254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with APC-Cy7.

MLEC Protein Vector (Mouse) (pPB-C-His)

PV201062 500 ng
EUR 603

MLEC Protein Vector (Mouse) (pPB-N-His)

PV201063 500 ng
EUR 603

MLEC Protein Vector (Mouse) (pPM-C-HA)

PV201064 500 ng
EUR 603

MLEC Protein Vector (Mouse) (pPM-C-His)

PV201065 500 ng
EUR 603

MLEC Protein Vector (Rat) (pPB-C-His)

PV282470 500 ng
EUR 603

MLEC Protein Vector (Rat) (pPB-N-His)

PV282471 500 ng
EUR 603

MLEC Protein Vector (Rat) (pPM-C-HA)

PV282472 500 ng
EUR 603

MLEC Protein Vector (Rat) (pPM-C-His)

PV282473 500 ng
EUR 603

MLEC Protein Vector (Human) (pPB-C-His)

PV026069 500 ng
EUR 329

MLEC Protein Vector (Human) (pPB-N-His)

PV026070 500 ng
EUR 329

MLEC Protein Vector (Human) (pPM-C-HA)

PV026071 500 ng
EUR 329

MLEC Protein Vector (Human) (pPM-C-His)

PV026072 500 ng
EUR 329

Recombinant Human MLEC Protein, His, E.coli-10ug

QP12700-10ug 10ug
EUR 201

Recombinant Human MLEC Protein, His, E.coli-1mg

QP12700-1mg 1mg
EUR 5251

Recombinant Human MLEC Protein, His, E.coli-2ug

QP12700-2ug 2ug
EUR 155

Mlec 3'UTR Luciferase Stable Cell Line

TU113236 1.0 ml Ask for price

Mlec 3'UTR GFP Stable Cell Line

TU163236 1.0 ml Ask for price

Mlec 3'UTR Luciferase Stable Cell Line

TU213227 1.0 ml Ask for price

Mlec 3'UTR GFP Stable Cell Line

TU263227 1.0 ml Ask for price

MLEC 3'UTR GFP Stable Cell Line

TU064344 1.0 ml
EUR 4617

MLEC 3'UTR Luciferase Stable Cell Line

TU014344 1.0 ml
EUR 4617

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV657643 1.0 ug DNA
EUR 514

MLEC Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV657647 1.0 ug DNA
EUR 514

MLEC Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV657648 1.0 ug DNA
EUR 514

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7294105 3 x 1.0 ug
EUR 376

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1307205 3 x 1.0 ug
EUR 376

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4531205 3 x 1.0 ug
EUR 376

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV657644 1.0 ug DNA
EUR 514

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV657645 1.0 ug DNA
EUR 572

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV657646 1.0 ug DNA
EUR 572

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7294106 1.0 ug DNA
EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7294107 1.0 ug DNA
EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7294108 1.0 ug DNA
EUR 167

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1307206 1.0 ug DNA
EUR 167

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1307207 1.0 ug DNA
EUR 167

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1307208 1.0 ug DNA
EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4531206 1.0 ug DNA
EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4531207 1.0 ug DNA
EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4531208 1.0 ug DNA
EUR 167