  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

INO80E cloning plasmid

CSB-CL011728HU-10ug 10ug
EUR 315
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atgaacgggccggcggacggcgaagtggactacaaaaaaaaataccggaatctgaagcggaagctcaagttcctcatctacgagcacgagtgcttccaggaggagctgaggaaagcgcaaaggaaattactgaaggtgtcccgggacaagagtttcctcctagaccgacttctgca
  • Show more
Description: A cloning plasmid for the INO80E gene.


PVT18936 2 ug
EUR 231

Rat INO80E shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human INO80E shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

INO80E Recombinant Protein (Human)

RP016177 100 ug Ask for price

INO80E Recombinant Protein (Rat)

RP206060 100 ug Ask for price

INO80E Recombinant Protein (Mouse)

RP143873 100 ug Ask for price

INO80E ORF Vector (Human) (pORF)

ORF005393 1.0 ug DNA
EUR 95

Ino80e ORF Vector (Rat) (pORF)

ORF068688 1.0 ug DNA
EUR 506

Ino80e ORF Vector (Mouse) (pORF)

ORF047959 1.0 ug DNA
EUR 506

Ino80e sgRNA CRISPR Lentivector set (Mouse)

K4535701 3 x 1.0 ug
EUR 339

Ino80e sgRNA CRISPR Lentivector set (Rat)

K6292801 3 x 1.0 ug
EUR 339

INO80E sgRNA CRISPR Lentivector set (Human)

K1089301 3 x 1.0 ug
EUR 339

Ino80e sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4535702 1.0 ug DNA
EUR 154

Ino80e sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4535703 1.0 ug DNA
EUR 154

Ino80e sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4535704 1.0 ug DNA
EUR 154

Ino80e sgRNA CRISPR Lentivector (Rat) (Target 1)

K6292802 1.0 ug DNA
EUR 154

Ino80e sgRNA CRISPR Lentivector (Rat) (Target 2)

K6292803 1.0 ug DNA
EUR 154

Ino80e sgRNA CRISPR Lentivector (Rat) (Target 3)

K6292804 1.0 ug DNA
EUR 154

INO80E sgRNA CRISPR Lentivector (Human) (Target 1)

K1089302 1.0 ug DNA
EUR 154

INO80E sgRNA CRISPR Lentivector (Human) (Target 2)

K1089303 1.0 ug DNA
EUR 154

INO80E sgRNA CRISPR Lentivector (Human) (Target 3)

K1089304 1.0 ug DNA
EUR 154

INO80E Protein Vector (Human) (pPB-C-His)

PV021569 500 ng
EUR 329

INO80E Protein Vector (Human) (pPB-N-His)

PV021570 500 ng
EUR 329

INO80E Protein Vector (Human) (pPM-C-HA)

PV021571 500 ng
EUR 329

INO80E Protein Vector (Human) (pPM-C-His)

PV021572 500 ng
EUR 329

INO80E Protein Vector (Rat) (pPB-C-His)

PV274750 500 ng
EUR 603

INO80E Protein Vector (Rat) (pPB-N-His)

PV274751 500 ng
EUR 603

INO80E Protein Vector (Rat) (pPM-C-HA)

PV274752 500 ng
EUR 603

INO80E Protein Vector (Rat) (pPM-C-His)

PV274753 500 ng
EUR 603

INO80E Protein Vector (Mouse) (pPB-C-His)

PV191834 500 ng
EUR 603

INO80E Protein Vector (Mouse) (pPB-N-His)

PV191835 500 ng
EUR 603

INO80E Protein Vector (Mouse) (pPM-C-HA)

PV191836 500 ng
EUR 603

INO80E Protein Vector (Mouse) (pPM-C-His)

PV191837 500 ng
EUR 603

Ino80e 3'UTR Luciferase Stable Cell Line

TU206306 1.0 ml Ask for price

Ino80e 3'UTR GFP Stable Cell Line

TU160131 1.0 ml Ask for price

INO80E 3'UTR Luciferase Stable Cell Line

TU011170 1.0 ml
EUR 1394

Ino80e 3'UTR Luciferase Stable Cell Line

TU110131 1.0 ml Ask for price

INO80E 3'UTR GFP Stable Cell Line

TU061170 1.0 ml
EUR 1394

Ino80e 3'UTR GFP Stable Cell Line

TU256306 1.0 ml Ask for price

Bovine INO80 complex subunit E, INO80E ELISA KIT

ELI-13394b 96 Tests
EUR 928

Human INO80 complex subunit E, INO80E ELISA KIT

ELI-39311h 96 Tests
EUR 824

INO80E Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679681 1.0 ug DNA
EUR 514

INO80E Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679685 1.0 ug DNA
EUR 514

INO80E Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679686 1.0 ug DNA
EUR 514

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4535705 3 x 1.0 ug
EUR 376

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6292805 3 x 1.0 ug
EUR 376

INO80E sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1089305 3 x 1.0 ug
EUR 376

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4535706 1.0 ug DNA
EUR 167

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4535707 1.0 ug DNA
EUR 167

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4535708 1.0 ug DNA
EUR 167

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6292806 1.0 ug DNA
EUR 167

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6292807 1.0 ug DNA
EUR 167

Ino80e sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6292808 1.0 ug DNA
EUR 167

INO80E sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1089306 1.0 ug DNA
EUR 167

INO80E sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1089307 1.0 ug DNA
EUR 167

INO80E sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1089308 1.0 ug DNA
EUR 167

INO80E Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV679682 1.0 ug DNA
EUR 514