  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW11 antibody

70R-2795 50 ug
EUR 467
Description: Rabbit polyclonal FBXW11 antibody raised against the N terminal of FBXW11

FBXW11 antibody

70R-2812 50 ug
EUR 467
Description: Rabbit polyclonal FBXW11 antibody raised against the N terminal of FBXW11

FBXW11 Antibody

35405-100ul 100ul
EUR 390

FBXW11 antibody

70R-17267 50 ul
EUR 435
Description: Rabbit polyclonal FBXW11 antibody

FBXW11 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW11. Recognizes FBXW11 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FBXW11 Antibody

DF13009 200ul
EUR 304
Description: FBXW11 Antibody detects endogenous levels of FBXW11.

FBXW11 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW11. Recognizes FBXW11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- FBXW11 antibody

FNab03052 100µg
EUR 505.25
  • Immunogen: F-box and WD repeat domain containing 11
  • Uniprot ID: Q9UKB1
  • Gene ID: 23291
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against FBXW11

FBXW11 Rabbit pAb

A7784-100ul 100 ul
EUR 308

FBXW11 Rabbit pAb

A7784-200ul 200 ul
EUR 459

FBXW11 Rabbit pAb

A7784-20ul 20 ul
EUR 183

FBXW11 Rabbit pAb

A7784-50ul 50 ul
EUR 223

FBXW11 Blocking Peptide

33R-1744 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW11 antibody, catalog no. 70R-2795

FBXW11 Blocking Peptide

33R-2627 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW11 antibody, catalog no. 70R-2812

FBXW11 Polyclonal Antibody

31330-100ul 100ul
EUR 252

FBXW11 Polyclonal Antibody

31330-50ul 50ul
EUR 187

FBXW11 Blocking Peptide

DF13009-BP 1mg
EUR 195

FBXW11 cloning plasmid

CSB-CL891721HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1590
  • Sequence: atggagcccgactcggtgattgaggacaagaccatcgagctcatgaacacttcagttatggaagatcaaaatgaagatgagtccccaaagaaaaatactctttggcagataagtaatggaacatcatctgtgatcgtctccagaaagaggccatcagaaggaaactatcaaaaag
  • Show more
Description: A cloning plasmid for the FBXW11 gene.

Anti-FBXW11 antibody

PAab03052 100 ug
EUR 355

Anti-FBXW11 antibody

STJ110094 100 µl
EUR 277
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons.

FBXW11 Polyclonal Conjugated Antibody

C31330 100ul
EUR 397

Mouse FBXW11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009593 96 Tests
EUR 689

Human FBXW11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW11 Recombinant Protein (Human)

RP011956 100 ug Ask for price

FBXW11 Recombinant Protein (Rat)

RP201068 100 ug Ask for price

FBXW11 Recombinant Protein (Mouse)

RP134093 100 ug Ask for price

FBXW11 ORF Vector (Human) (pORF)

ORF003986 1.0 ug DNA
EUR 95

Fbxw11 ORF Vector (Rat) (pORF)

ORF067024 1.0 ug DNA
EUR 506

Fbxw11 ORF Vector (Mouse) (pORF)

ORF044699 1.0 ug DNA
EUR 506

FBXW11 sgRNA CRISPR Lentivector set (Human)

K0768101 3 x 1.0 ug
EUR 339

Fbxw11 sgRNA CRISPR Lentivector set (Mouse)

K4923101 3 x 1.0 ug
EUR 339

Fbxw11 sgRNA CRISPR Lentivector set (Rat)

K6621901 3 x 1.0 ug
EUR 339

FBXW11 sgRNA CRISPR Lentivector (Human) (Target 1)

K0768102 1.0 ug DNA
EUR 154

FBXW11 sgRNA CRISPR Lentivector (Human) (Target 2)

K0768103 1.0 ug DNA
EUR 154

FBXW11 sgRNA CRISPR Lentivector (Human) (Target 3)

K0768104 1.0 ug DNA
EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4923102 1.0 ug DNA
EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4923103 1.0 ug DNA
EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4923104 1.0 ug DNA
EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6621902 1.0 ug DNA
EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6621903 1.0 ug DNA
EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6621904 1.0 ug DNA
EUR 154

FBXW11 Protein Vector (Mouse) (pPB-C-His)

PV178794 500 ng
EUR 603

FBXW11 Protein Vector (Mouse) (pPB-N-His)

PV178795 500 ng
EUR 603

FBXW11 Protein Vector (Mouse) (pPM-C-HA)

PV178796 500 ng
EUR 603

FBXW11 Protein Vector (Mouse) (pPM-C-His)

PV178797 500 ng
EUR 603

FBXW11 Protein Vector (Human) (pPB-C-His)

PV015941 500 ng
EUR 329

FBXW11 Protein Vector (Human) (pPB-N-His)

PV015942 500 ng
EUR 329

FBXW11 Protein Vector (Human) (pPM-C-HA)

PV015943 500 ng
EUR 329

FBXW11 Protein Vector (Human) (pPM-C-His)

PV015944 500 ng
EUR 329

FBXW11 Protein Vector (Rat) (pPB-C-His)

PV268094 500 ng
EUR 603

FBXW11 Protein Vector (Rat) (pPB-N-His)

PV268095 500 ng
EUR 603

FBXW11 Protein Vector (Rat) (pPM-C-HA)

PV268096 500 ng
EUR 603

FBXW11 Protein Vector (Rat) (pPM-C-His)

PV268097 500 ng
EUR 603

Fbxw11 3'UTR Luciferase Stable Cell Line

TU204527 1.0 ml Ask for price

Fbxw11 3'UTR GFP Stable Cell Line

TU156447 1.0 ml Ask for price

FBXW11 3'UTR Luciferase Stable Cell Line

TU007818 1.0 ml
EUR 1521

Fbxw11 3'UTR Luciferase Stable Cell Line

TU106447 1.0 ml Ask for price

FBXW11 3'UTR GFP Stable Cell Line

TU057818 1.0 ml
EUR 1521

Fbxw11 3'UTR GFP Stable Cell Line

TU254527 1.0 ml Ask for price

FBXW11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621163 1.0 ug DNA
EUR 682

FBXW11 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621167 1.0 ug DNA
EUR 682

FBXW11 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621168 1.0 ug DNA
EUR 682

FBXW11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0768105 3 x 1.0 ug
EUR 376

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody

abx036648-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody

abx036649-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody

abx026152-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.