EIF2S2 Antibody

33102-100ul 100ul
EUR 252

EIF2S2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EIF2S2 Antibody

DF4050 200ul
EUR 304
Description: EIF2S2 Antibody detects endogenous levels of total EIF2S2.

EIF2S2 antibody

70R-36848 100 ug
EUR 327
Description: Rabbit Polyclonal EIF2S2 antibody

EIF2S2 antibody

70R-4904 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 antibody

70R-4905 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EIF2S2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2S2 Antibody

ABD4050 100 ug
EUR 438


PVT18393 2 ug
EUR 231

EIF2S2 Rabbit pAb

A14498-100ul 100 ul
EUR 308

EIF2S2 Rabbit pAb

A14498-200ul 200 ul
EUR 459

EIF2S2 Rabbit pAb

A14498-20ul 20 ul
EUR 183

EIF2S2 Rabbit pAb

A14498-50ul 50 ul
EUR 223

EIF2S2 Blocking Peptide

33R-1911 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4904

EIF2S2 Blocking Peptide

33R-9251 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4905

EIF2S2 Blocking Peptide

DF4050-BP 1mg
EUR 195

EIF2S2 (pS67) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EIF2S2 Conjugated Antibody

C33102 100ul
EUR 397

EIF2S2 cloning plasmid

CSB-CL007524HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid

CSB-CL007524HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgagga
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid

CSB-CL007524HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 Rabbit pAb

A5894-100ul 100 ul
EUR 308

EIF2S2 Rabbit pAb

A5894-200ul 200 ul
EUR 459

EIF2S2 Rabbit pAb

A5894-20ul 20 ul
EUR 183

EIF2S2 Rabbit pAb

A5894-50ul 50 ul
EUR 223

EIF2S2 (pS2) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- EIF2S2 antibody

FNab02700 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
  • Uniprot ID: P20042
  • Gene ID: 8894
  • Research Area: Metabolism
Description: Antibody raised against EIF2S2

Anti-EIF2S2 Antibody

PA2157 100ug/vial
EUR 294

Anti-EIF2S2 antibody

PAab02700 100 ug
EUR 386

pENTR223-EIF2S2 vector

PVT11718 2 ug
EUR 304


PVT18199 2 ug
EUR 231

Anti-EIF2S2 antibody

STJ28167 100 µl
EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 antibody

STJ116709 100 µl
EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 (2F3)

YF-MA16593 100 ug
EUR 363
Description: Mouse monoclonal to EIF2S2

Phospho-EIF2S2 (Ser2) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EIF2S2 (Ser2) Antibody

CSB-PA790061-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EIF2S2 (Ab-67) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 (Ab-67) Antibody

CSB-PA566738-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 (pS67) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


ELI-08424b 96 Tests
EUR 928


EF009336 96 Tests
EUR 689


ELI-43377h 96 Tests
EUR 824

Mouse EIF2S2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2S2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Eif2s2 ELISA KIT

ELI-48691m 96 Tests
EUR 865


PVT13567 2 ug
EUR 599

EIF2S2 Recombinant Protein (Human)

RP010384 100 ug Ask for price

EIF2S2 Recombinant Protein (Human)

RP010387 100 ug Ask for price

EIF2S2 Recombinant Protein (Human)

RP010390 100 ug Ask for price

EIF2S2 Recombinant Protein (Rat)

RP199331 100 ug Ask for price

EIF2S2 Recombinant Protein (Mouse)

RP131258 100 ug Ask for price

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-100ul 100 ul
EUR 384

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-200ul 200 ul
EUR 554

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-20ul 20 ul Ask for price

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-50ul 50 ul
EUR 265

Eif2s2 ORF Vector (Rat) (pORF)

ORF066445 1.0 ug DNA
EUR 506

EIF2S2 ORF Vector (Human) (pORF)

ORF003462 1.0 ug DNA
EUR 95

EIF2S2 ORF Vector (Human) (pORF)

ORF003463 1.0 ug DNA
EUR 95

EIF2S2 ORF Vector (Human) (pORF)

ORF003464 1.0 ug DNA
EUR 95

Eif2s2 ORF Vector (Mouse) (pORF)

ORF043754 1.0 ug DNA
EUR 506

Anti-Phospho-EIF2S2-(S2) antibody

STJ22114 100 µl
EUR 393
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Eif2s2 sgRNA CRISPR Lentivector set (Mouse)

K4867501 3 x 1.0 ug
EUR 339

EIF2S2 sgRNA CRISPR Lentivector set (Human)

K0666501 3 x 1.0 ug
EUR 339

Eif2s2 sgRNA CRISPR Lentivector set (Rat)

K7228601 3 x 1.0 ug
EUR 339

Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4867502 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4867503 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4867504 1.0 ug DNA
EUR 154