Beopenlab

Dexamethasone
CA057-001	GenDepot	1g	EUR 196

Dexamethasone
AT023	Unibiotest	1mg	EUR 1790

Dexamethasone
E1KS1322	EnoGene	100mg	EUR 247

Dexamethasone
HY-14648	MedChemExpress	10mM/1mL	EUR 113

Dexamethasone
GP8543-1G	Glentham Life Sciences	1 g	EUR 90

Dexamethasone
GP8543-250MG	Glentham Life Sciences	250 mg	EUR 54

Dexamethasone
GP8543-5G	Glentham Life Sciences	5 g	EUR 166

Dexamethasone
20-abx076546	Abbexa	EUR 244.00 EUR 509.00	1 g 5 g
Shipped within 5-12 working days.

Dexamethasone
20-abx082283	Abbexa	EUR 217.00 EUR 384.00	100 mg 1 g
Shipped within 5-10 working days.

Dexamethasone
abx183974-5g	Abbexa	5 g	EUR 370
Shipped within 1-2 weeks.

Dexamethasone
1042-10G	Biovision		EUR 659

Dexamethasone
1042-1G	Biovision		EUR 191

SDS
SB0485	Bio Basic	100g	EUR 67.4
Product category: Biochemicals/Detergents/Surfactants

Dexamethasone acetate
B1926-100	ApexBio	100 mg	EUR 166
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate
B1926-5	ApexBio	5 mg	EUR 108
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate
B1926-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 142
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone palmitate
HY-128922	MedChemExpress	50mg	EUR 245

Dexamethasone (acetate)
HY-14648A	MedChemExpress	5g	EUR 199

Dexamethasone-HRP
80-1142	Fitzgerald	500 ul	EUR 417
Description: Dexamethasone 21 Conjugate for use in immunoassays

Dexamethasone (DHAP)
A2324-100	ApexBio	100 mg	EUR 166
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-1000	ApexBio	1 g	EUR 139
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-5	ApexBio	5 mg	EUR 108
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 154
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-5000	ApexBio	5 g	EUR 293
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Sds/ Rat Sds ELISA Kit
ELI-15462r	Lifescience Market	96 Tests	EUR 886

SDS siRNA
20-abx904833	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SDS antibody
70R-3627	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody
70R-3762	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS Solution
2102-100	Biovision		EUR 137

SDS antibody
10R-5712	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
10R-5718	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
10R-5720	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS siRNA
20-abx932743	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SDS siRNA
20-abx932744	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

10% SDS
TG4060	TopoGen	1ml	EUR 134

anti-SDS
YF-PA17352	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SDS

Dexamethasone Sodium Phosphate
B1588-100	ApexBio	100 mg	EUR 166
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone Sodium Phosphate
B1588-5	ApexBio	5 mg	EUR 108
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone phosphate disodium
HY-B1829A	MedChemExpress	10mM/1mL	EUR 113

Dexamethasone 9,11-epoxide
HY-N0348	MedChemExpress	10mM/1mL	EUR 126

Dexamethasone phosphate sodium
20-abx183975	Abbexa	EUR 342.00 EUR 648.00	1 g 5 g
Shipped within 1-2 weeks.

Dexamethasone Hemisuccinate Antibody
abx411076-1ml	Abbexa	1 ml	EUR 439
Shipped within 1 week.

Dexamethasone (10 mM)
1042-1	Biovision		EUR 153

Dexamethasone 21 antibody
20-1436	Fitzgerald	100 ul	EUR 657
Description: Sheep polyclonal Dexamethasone 21 antibody

Dexamethasone(21) [HRP]
DAG1086	Creative Diagnostics	0.5ml	EUR 714

Dexamethasone phosphate disodium
B2744-1G	Biovision	1 g	EUR 115

Dexamethasone phosphate disodium
B2744-5G	Biovision	5 g	EUR 277

dAbs scaffold protein anti-Human B5R
SDS-L073	Creative Biolabs	1 mg	EUR 4496
Description: Scaffold protein

TT-SDS (Tris-Tricine-SDS buffer) Premix powder
TD8135	Bio Basic	1PK, 10L	EUR 76.1
Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4
UA0030	Bio Basic	500ml	EUR 67.4
Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution
A0030	Bio Basic	4L	EUR 94.8
Product category: Biochemicals/Biological Buffers/Common Buffers

SDS cloning plasmid
CSB-CL020926HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca Show more
Description: A cloning plasmid for the SDS gene.

SDS Rabbit pAb
A12898-100ul	Abclonal	100 ul	EUR 308

SDS Rabbit pAb
A12898-200ul	Abclonal	200 ul	EUR 459

SDS Rabbit pAb
A12898-20ul	Abclonal	20 ul	EUR 183

SDS Rabbit pAb
A12898-50ul	Abclonal	50 ul	EUR 223

SDS Blocking Peptide
33R-4446	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide
33R-1011	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS Polyclonal Antibody
27842-100ul	SAB	100ul	EUR 252

SDS Polyclonal Antibody
27842-50ul	SAB	50ul	EUR 187

100G SDS Ultrapure
NAT1072	National Diagnostics	100G	EUR 93

1KG SDS Ultrapure
NAT1074	National Diagnostics	1KG	EUR 306

101Bio SDS-Remover
P5W12	101Bio	NULL	EUR 0

10% SDS Solution
S0792-050	GenDepot	500ml	EUR 93

10% SDS Solution
S0792-100	GenDepot	2X500ml	EUR 122

20% SDS Solution
S0793-050	GenDepot	500ml	EUR 120

20% SDS Solution
S0793-100	GenDepot	2X500ml	EUR 166

SurfactAway™ SDS
SA645-30	Biotech Support Group	30 mL	EUR 379

SurfactAway™ SDS
SA646-250	Biotech Support Group	250 mL	EUR 1389

Anti-SDS antibody
STJ114764	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.