CHCHD4 siRNA

20-abx901030
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHCHD4 siRNA

20-abx911649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHCHD4 siRNA

20-abx911650
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHCHD4 antibody

70R-2526 50 ug
EUR 467
Description: Rabbit polyclonal CHCHD4 antibody raised against the N terminal of CHCHD4

CHCHD4 antibody

70R-16381 50 ul
EUR 435
Description: Rabbit polyclonal CHCHD4 antibody

CHCHD4 Antibody

DF12364 200ul
EUR 304
Description: CHCHD4 antibody detects endogenous levels of CHCHD4.

CHCHD4 Antibody

1-CSB-PA005319GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CHCHD4 Antibody

1-CSB-PA850802HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti- CHCHD4 antibody

FNab01637 100µg
EUR 505.25
  • Immunogen: coiled-coil-helix-coiled-coil-helix domain containing 4
  • Uniprot ID: Q8N4Q1
  • Gene ID: 131474
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CHCHD4

CHCHD4 Rabbit pAb

A9453-100ul 100 ul
EUR 308

CHCHD4 Rabbit pAb

A9453-200ul 200 ul
EUR 459

CHCHD4 Rabbit pAb

A9453-20ul 20 ul Ask for price

CHCHD4 Rabbit pAb

A9453-50ul 50 ul Ask for price

CHCHD4 Polyclonal Antibody

A56314 100 µg
EUR 570.55
Description: Ask the seller for details

CHCHD4 Rabbit pAb

A13139-100ul 100 ul
EUR 308

CHCHD4 Rabbit pAb

A13139-200ul 200 ul
EUR 459

CHCHD4 Rabbit pAb

A13139-20ul 20 ul
EUR 183

CHCHD4 Rabbit pAb

A13139-50ul 50 ul
EUR 223

CHCHD4 Blocking Peptide

33R-6527 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHCHD4 antibody, catalog no. 70R-2526

CHCHD4 Polyclonal Antibody

27915-100ul 100ul
EUR 252

CHCHD4 Polyclonal Antibody

27915-50ul 50ul
EUR 187

CHCHD4 Blocking Peptide

DF12364-BP 1mg
EUR 195

CHCHD4 cloning plasmid

CSB-CL850802HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgtcctattgccggcaggaagggaaggatcgaatcatatttgtaaccaaagaagatcatgaaactccaagcagtgcagaattggtggctgatgaccccaacgatccatacgaggagcatggattgatactgccaaatggaaacattaactggaactgcccatgccttgggggaat
  • Show more
Description: A cloning plasmid for the CHCHD4 gene.

Anti-CHCHD4 antibody

PAab01637 100 ug
EUR 355

Anti-CHCHD4 antibody

STJ111705 100 µl
EUR 277

Anti-CHCHD4 antibody

STJ115105 100 µl
EUR 277

CHCHD4 Polyclonal Conjugated Antibody

C27915 100ul
EUR 397

Mouse CHCHD4 shRNA Plasmid

20-abx977702
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CHCHD4 shRNA Plasmid

20-abx989723
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CHCHD4 shRNA Plasmid

20-abx965064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CHCHD4 ELISA KIT

ELI-14027h 96 Tests
EUR 824

Bovine CHCHD4 ELISA KIT

ELI-23464b 96 Tests
EUR 928

Mouse Chchd4 ELISA KIT

ELI-23465m 96 Tests
EUR 865

CHCHD4 ELISA KIT|Human

EF008627 96 Tests
EUR 689

CHCHD4 Antibody, HRP conjugated

1-CSB-PA850802HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CHCHD4 Antibody, FITC conjugated

1-CSB-PA850802HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CHCHD4 Antibody, Biotin conjugated

1-CSB-PA850802HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CHCHD4 Recombinant Protein (Human)

RP006958 100 ug Ask for price

CHCHD4 Recombinant Protein (Rat)

RP194783 100 ug Ask for price

CHCHD4 Recombinant Protein (Mouse)

RP123818 100 ug Ask for price

CHCHD4 Polyclonal Antibody, HRP Conjugated

A56315 100 µg
EUR 570.55
Description: The best epigenetics products

CHCHD4 Polyclonal Antibody, FITC Conjugated

A56316 100 µg
EUR 570.55
Description: kits suitable for this type of research

CHCHD4 Polyclonal Antibody, Biotin Conjugated

A56317 100 µg
EUR 570.55
Description: fast delivery possible

CHCHD4 ORF Vector (Human) (pORF)

ORF002320 1.0 ug DNA
EUR 95

Chchd4 ORF Vector (Mouse) (pORF)

ORF041274 1.0 ug DNA
EUR 506

Chchd4 ORF Vector (Rat) (pORF)

ORF064929 1.0 ug DNA
EUR 506

CHCHD4 sgRNA CRISPR Lentivector set (Human)

K0441901 3 x 1.0 ug
EUR 339

Chchd4 sgRNA CRISPR Lentivector set (Mouse)

K4735601 3 x 1.0 ug
EUR 339

Chchd4 sgRNA CRISPR Lentivector set (Rat)

K7300001 3 x 1.0 ug
EUR 339

CHCHD4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0441902 1.0 ug DNA
EUR 154

CHCHD4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0441903 1.0 ug DNA
EUR 154

CHCHD4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0441904 1.0 ug DNA
EUR 154

Chchd4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4735602 1.0 ug DNA
EUR 154

Chchd4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4735603 1.0 ug DNA
EUR 154

Chchd4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4735604 1.0 ug DNA
EUR 154

Chchd4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7300002 1.0 ug DNA
EUR 154

Chchd4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7300003 1.0 ug DNA
EUR 154

Chchd4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7300004 1.0 ug DNA
EUR 154

CHCHD4 Protein Vector (Human) (pPB-C-His)

PV009277 500 ng
EUR 329

CHCHD4 Protein Vector (Human) (pPB-N-His)

PV009278 500 ng
EUR 329

CHCHD4 Protein Vector (Human) (pPM-C-HA)

PV009279 500 ng
EUR 329

CHCHD4 Protein Vector (Human) (pPM-C-His)

PV009280 500 ng
EUR 329

CHCHD4 Protein Vector (Rat) (pPB-C-His)

PV259714 500 ng
EUR 603

CHCHD4 Protein Vector (Rat) (pPB-N-His)

PV259715 500 ng
EUR 603

CHCHD4 Protein Vector (Rat) (pPM-C-HA)

PV259716 500 ng
EUR 603

CHCHD4 Protein Vector (Rat) (pPM-C-His)

PV259717 500 ng
EUR 603

CHCHD4 Protein Vector (Mouse) (pPB-C-His)

PV165094 500 ng
EUR 603

CHCHD4 Protein Vector (Mouse) (pPB-N-His)

PV165095 500 ng
EUR 603

CHCHD4 Protein Vector (Mouse) (pPM-C-HA)

PV165096 500 ng
EUR 603

CHCHD4 Protein Vector (Mouse) (pPM-C-His)

PV165097 500 ng
EUR 603

Chchd4 3'UTR Luciferase Stable Cell Line

TU202260 1.0 ml Ask for price

Chchd4 3'UTR GFP Stable Cell Line

TU153807 1.0 ml Ask for price

CHCHD4 3'UTR Luciferase Stable Cell Line

TU004320 1.0 ml
EUR 1394

Chchd4 3'UTR Luciferase Stable Cell Line

TU103807 1.0 ml Ask for price

CHCHD4 3'UTR GFP Stable Cell Line

TU054320 1.0 ml
EUR 1394

Chchd4 3'UTR GFP Stable Cell Line

TU252260 1.0 ml Ask for price

CHCHD4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV685717 1.0 ug DNA
EUR 514

CHCHD4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV685721 1.0 ug DNA
EUR 514

CHCHD4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV685722 1.0 ug DNA
EUR 514

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-100ug

QP7968-ec-100ug 100ug
EUR 408

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-10ug

QP7968-ec-10ug 10ug
EUR 200

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-1mg

QP7968-ec-1mg 1mg
EUR 1632

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-200ug

QP7968-ec-200ug 200ug
EUR 634

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-500ug

QP7968-ec-500ug 500ug
EUR 1060

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-50ug

QP7968-ec-50ug 50ug
EUR 263

CHCHD4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0441905 3 x 1.0 ug
EUR 376

Chchd4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4735605 3 x 1.0 ug
EUR 376

Human Mitochondrial intermembrane space import and assembly protein 40 (CHCHD4)

1-CSB-EP850802HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mitochondrial intermembrane space import and assembly protein 40(CHCHD4) expressed in E.coli

Chchd4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7300005 3 x 1.0 ug
EUR 376

CHCHD4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0441906 1.0 ug DNA
EUR 167