cdc25A antibody

20R-1992 50 ug
EUR 281
Description: Rabbit polyclonal cdc25A antibody

cdc25A antibody

20R-2333 50 ug
EUR 281
Description: Rabbit polyclonal cdc25A antibody

CDC25A antibody

70R-10483 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CDC25A antibody

CDC25A antibody

70R-14083 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CDC25A antibody

CDC25A Antibody

35386-100ul 100ul
EUR 390

CDC25A Antibody

32202-100ul 100ul
EUR 252

CDC25A antibody

10R-8626 100 ul
EUR 393
Description: Mouse monoclonal CDC25A antibody

CDC25A Antibody

CSB-PA004994KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDC25A Antibody

CSB-PA004994KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDC25A Antibody

1-CSB-PA080095
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CDC25A Antibody

1-CSB-PA080096
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CDC25A Antibody

1-CSB-PA080097
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

CDC25A Antibody

1-CSB-PA080098
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

CDC25A Antibody

1-CSB-PA12709A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CDC25A Antibody

DF6307 200ul
EUR 304
Description: CDC25A Antibody detects endogenous levels of total CDC25A.

CDC25A Antibody

1-CSB-PA281759
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CDC25A Antibody

1-CSB-PA206399
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CDC25A Antibody

1-CSB-PA244825
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

cdc25A antibody

70R-36265 100 ug
EUR 327
Description: Rabbit polyclonal cdc25A antibody

CDC25A antibody

70R-37599 100 ug
EUR 273
Description: Rabbit Polyclonal CDC25A antibody

CDC25A antibody

70R-49512 100 ul
EUR 287
Description: Purified Polyclonal CDC25A antibody

CDC25A antibody

70R-49513 100 ul
EUR 287
Description: Purified Polyclonal CDC25A antibody

CDC25A antibody

70R-33494 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody

CDC25A Antibody

AF6252 200ul
EUR 304
Description: CDC25A Antibody detects endogenous levels of total CDC25A.

CDC25A siRNA

20-abx900932
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC25A siRNA

20-abx911124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC25A siRNA

20-abx911125
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC25A Antibody

ABF6252 100 ug
EUR 438

CDC25A Antibody

ABD6307 100 ug
EUR 438

anti-CDC25A

YF-PA10833 50 ug
EUR 363
Description: Mouse polyclonal to CDC25A

anti-CDC25A

YF-PA10834 100 ul
EUR 403
Description: Rabbit polyclonal to CDC25A

anti-CDC25A

YF-PA10835 100 ug
EUR 403
Description: Rabbit polyclonal to CDC25A

CDC25A antibody (Ser75)

70R-31069 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody (Ser75)

CDC25A Rabbit pAb

A1173-100ul 100 ul
EUR 308

CDC25A Rabbit pAb

A1173-200ul 200 ul
EUR 459

CDC25A Rabbit pAb

A1173-20ul 20 ul
EUR 183

CDC25A Rabbit pAb

A1173-50ul 50 ul
EUR 223

CDC25A Blocking Peptide

33R-5934 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC25A antibody, catalog no. 70R-10483

Cdc25A Polyclonal Antibody

40714-100ul 100ul
EUR 252

Cdc25A Polyclonal Antibody

40714-50ul 50ul
EUR 187

CDC25A Blocking Peptide

DF6307-BP 1mg
EUR 195

CDC25A antibody (Ser75)

70R-35710 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody (Ser75)

cdc25A antibody (Ser75)

70R-37217 100 ug
EUR 349
Description: Rabbit Polyclonal cdc25A antibody (Ser75)

CDC25A antibody (Thr507)

70R-32593 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody (Thr507)

CDC25A antibody (Ser178)

70R-32594 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody (Ser178)

CDC25A antibody (Ser124)

70R-33493 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody (Ser124)

CDC25A (pS75) Antibody

20-abx009745
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody

20-abx009746
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody

abx010530-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody

abx010531-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody

abx010532-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS178) Antibody

abx010534-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody

abx010535-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody

abx010536-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS76) Antibody

20-abx119170
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody

20-abx119341
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody

20-abx121336
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS178) Antibody

20-abx121926
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS82) Antibody

abx149119-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A Blocking Peptide

20-abx161334
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CDC25A Blocking Peptide

20-abx161335
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody

abx031838-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody

abx031838-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS278) Antibody

abx031840-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS278) Antibody

abx031840-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS293) Antibody

abx031841-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS293) Antibody

abx031841-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody

abx031842-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody

abx031842-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody

abx031843-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody

abx031843-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cdc25A (pS79) Antibody

abx032018-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cdc25A (pS79) Antibody

abx032018-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A Blocking Peptide

AF6252-BP 1mg
EUR 195

CDC25A (pS178) Antibody

abx333343-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody

abx333450-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

CDC25A cloning plasmid

CSB-CL004994HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1575
  • Sequence: atggaactgggcccggagcccccgcaccgccgccgcctgctcttcgcctgcagcccccctcccgcgtcgcagcccgtcgtgaaggcgctatttggcgcttcagccgccgggggactgtcgcctgtcaccaacctgaccgtcactatggaccagctgcagggtctgggcagtgatt
  • Show more
Description: A cloning plasmid for the CDC25A gene.

Cdc25A Polyclonal Antibody

ABP50927-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124

Cdc25A Polyclonal Antibody

ABP50927-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124

Cdc25A Polyclonal Antibody

ABP50927-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124

CDC25A Rabbit pAb

A5527-100ul 100 ul
EUR 308

CDC25A Rabbit pAb

A5527-200ul 200 ul
EUR 459

CDC25A Rabbit pAb

A5527-20ul 20 ul Ask for price

CDC25A Rabbit pAb

A5527-50ul 50 ul
EUR 223

CDC25A Rabbit pAb

A2687-100ul 100 ul
EUR 308

CDC25A Rabbit pAb

A2687-200ul 200 ul
EUR 459

CDC25A Rabbit pAb

A2687-20ul 20 ul Ask for price

CDC25A Rabbit pAb

A2687-50ul 50 ul
EUR 223

Cdc25A Polyclonal Antibody

ABP57132-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507

Cdc25A Polyclonal Antibody

ABP57132-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507