Beopenlab

B3GNT6 siRNA
20-abx908784	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

B3GNT6 siRNA
20-abx908785	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-B3GNT6
YF-PA22642	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to B3GNT6

B3GNT6 Polyclonal Antibody
28788-100ul	SAB	100ul	EUR 252

B3GNT6 Polyclonal Antibody
28788-50ul	SAB	50ul	EUR 187

B3GNT6 Polyclonal Antibody
28789-100ul	SAB	100ul	EUR 252

B3GNT6 Polyclonal Antibody
28789-50ul	SAB	50ul	EUR 187

B3GNT6 cloning plasmid
CSB-CL744392HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1155 Sequence: ATGGCTTTTCCCTGCCGCAGGTCCCTGACTGCCAAGACTCTGGCCTGCCTCCTGGTGGGCGTGAGTTTCTTAGCACTGCAGCAGTGGTTCCTCCAGGCGCCAAGGTCCCCGCGGGAGGAGAGGTCCCCGCAGGAGGAGACGCCAGAGGGTCCCACCGACGCTCCCGCGGCTGACG Show more
Description: A cloning plasmid for the B3GNT6 gene.

B3GNT6 Rabbit pAb
A14974-100ul	Abclonal	100 ul	EUR 308

B3GNT6 Rabbit pAb
A14974-200ul	Abclonal	200 ul	EUR 459

B3GNT6 Rabbit pAb
A14974-20ul	Abclonal	20 ul	EUR 183

B3GNT6 Rabbit pAb
A14974-50ul	Abclonal	50 ul	EUR 223

B3GNT6 Rabbit pAb
A14975-100ul	Abclonal	100 ul	EUR 308

B3GNT6 Rabbit pAb
A14975-200ul	Abclonal	200 ul	EUR 459

B3GNT6 Rabbit pAb
A14975-20ul	Abclonal	20 ul	EUR 183

B3GNT6 Rabbit pAb
A14975-50ul	Abclonal	50 ul	EUR 223

Anti-B3GNT6 antibody
STJ117173	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a beta-1,3-N-acetylglucosaminyltransferase that adds an N-acetylglucosamine moiety to N-acetylgalactosamine-modified serine or threonine. The encoded enzyme is responsible for creating the core 3 structure of O-glycans, which are important components of mucin-type glycoproteins.

Anti-B3GNT6 antibody
STJ117174	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a beta-1,3-N-acetylglucosaminyltransferase that adds an N-acetylglucosamine moiety to N-acetylgalactosamine-modified serine or threonine. The encoded enzyme is responsible for creating the core 3 structure of O-glycans, which are important components of mucin-type glycoproteins.

B3GNT6 Antibody, HRP conjugated
1-CSB-PA744392LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B3GNT6. Recognizes B3GNT6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

B3GNT6 Antibody, FITC conjugated
1-CSB-PA744392LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B3GNT6. Recognizes B3GNT6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

B3GNT6 Antibody, Biotin conjugated
1-CSB-PA744392LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B3GNT6. Recognizes B3GNT6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal B3GNT6 Antibody (Center)
APR10862G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human B3GNT6 (Center). This antibody is tested and proven to work in the following applications:

Human B3GNT6 ELISA KIT
ELI-23963h	Lifescience Market	96 Tests	EUR 824

Mouse B3gnt6 ELISA KIT
ELI-23964m	Lifescience Market	96 Tests	EUR 865

Human B3GNT6 shRNA Plasmid
20-abx966152	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

B3GNT6 Polyclonal Conjugated Antibody
C28788	SAB	100ul	EUR 397

B3GNT6 Polyclonal Conjugated Antibody
C28789	SAB	100ul	EUR 397

Mouse B3GNT6 shRNA Plasmid
20-abx983149	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

B3GNT6 Recombinant Protein (Human)
RP036886	ABM	100 ug	Ask for price

B3GNT6 Recombinant Protein (Mouse)
RP118529	ABM	100 ug	Ask for price

B3GNT6 Recombinant Protein (Rat)
RP191747	ABM	100 ug	Ask for price

B3GNT6, soluble fragment, Human Recombinant
P1221-5	Biovision		EUR 240

B3gnt6 ORF Vector (Rat) (pORF)
ORF063917	ABM	1.0 ug DNA	EUR 506

B3GNT6 ORF Vector (Human) (pORF)
ORF012296	ABM	1.0 ug DNA	EUR 354

B3gnt6 ORF Vector (Mouse) (pORF)
ORF039511	ABM	1.0 ug DNA	EUR 506

B3gnt6 sgRNA CRISPR Lentivector set (Rat)
K6101801	ABM	3 x 1.0 ug	EUR 339

B3gnt6 sgRNA CRISPR Lentivector set (Mouse)
K3573101	ABM	3 x 1.0 ug	EUR 339

B3GNT6 sgRNA CRISPR Lentivector set (Human)
K0164201	ABM	3 x 1.0 ug	EUR 339

B3gnt6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6101802	ABM	1.0 ug DNA	EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6101803	ABM	1.0 ug DNA	EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6101804	ABM	1.0 ug DNA	EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3573102	ABM	1.0 ug DNA	EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3573103	ABM	1.0 ug DNA	EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3573104	ABM	1.0 ug DNA	EUR 154

B3GNT6 sgRNA CRISPR Lentivector (Human) (Target 1)
K0164202	ABM	1.0 ug DNA	EUR 154

B3GNT6 sgRNA CRISPR Lentivector (Human) (Target 2)
K0164203	ABM	1.0 ug DNA	EUR 154

B3GNT6 sgRNA CRISPR Lentivector (Human) (Target 3)
K0164204	ABM	1.0 ug DNA	EUR 154

B3GNT6 Protein Vector (Mouse) (pPB-C-His)
PV158042	ABM	500 ng	EUR 603

B3GNT6 Protein Vector (Mouse) (pPB-N-His)
PV158043	ABM	500 ng	EUR 603

B3GNT6 Protein Vector (Mouse) (pPM-C-HA)
PV158044	ABM	500 ng	EUR 603