anti- CFP antibody

FNab01622 100µg
EUR 505.25
  • Immunogen: complement factor properdin
  • Uniprot ID: P27918
  • Gene ID: 5199
  • Research Area: Immunology
Description: Antibody raised against CFP

Anti-CFP antibody

PAab01622 100 ug
EUR 355

Anti-CFP antibody

STJ27351 100 µl
EUR 277
Description: This gene encodes a plasma glycoprotein that positively regulates the alternative complement pathway of the innate immune system. This protein binds to many microbial surfaces and apoptotic cells and stabilizes the C3- and C5-convertase enzyme complexes in a feedback loop that ultimately leads to formation of the membrane attack complex and lysis of the target cell. Mutations in this gene result in two forms of properdin deficiency, which results in high susceptibility to meningococcal infections. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-CFP antibody

STJ118854 100 µl
EUR 277

Anti-CFP antibody

STJ118855 100 µl
EUR 277

Human Complement Factor P (CFP) ELISA Kit

DLR-CFP-Hu-48T 48T
EUR 479
  • Should the Human Complement Factor P (CFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Complement Factor P (CFP) in samples from serum, plasma or other biological fluids.

Human Complement Factor P (CFP) ELISA Kit

DLR-CFP-Hu-96T 96T
EUR 621
  • Should the Human Complement Factor P (CFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Complement Factor P (CFP) in samples from serum, plasma or other biological fluids.

Human Complement Factor P (CFP) ELISA Kit

RDR-CFP-Hu-48Tests 48 Tests
EUR 500

Human Complement Factor P (CFP) ELISA Kit

RDR-CFP-Hu-96Tests 96 Tests
EUR 692

Human Complement Factor P (CFP) ELISA Kit

RD-CFP-Hu-48Tests 48 Tests
EUR 478

Human Complement Factor P (CFP) ELISA Kit

RD-CFP-Hu-96Tests 96 Tests
EUR 662

Mouse Cardiac Fatty acid binding protein (CFP/FABP) ELISA kit

600-310-CFP 1 Kit
EUR 834

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

CFP antibody

20R-1864 100 ug
EUR 673
Description: Rabbit polyclonal CFP antibody

CFP antibody

70R-12454 100 ug
EUR 460
Description: Rabbit polyclonal CFP antibody

CFP Antibody

32828-100ul 100ul
EUR 252

CFP Antibody

EUR 370

CFP Antibody

EUR 146

CFP Antibody

DF7320 200ul
EUR 304
Description: CFP Antibody detects endogenous levels of total CFP.

CFP antibody

70R-5908 50 ug
EUR 467
Description: Rabbit polyclonal CFP antibody raised against the N terminal of CFP

CFP antibody

70R-5909 50 ug
EUR 467
Description: Rabbit polyclonal CFP antibody raised against the middle region of CFP


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CFP Antibody

ABD7320 100 ug
EUR 438

pA7- CFP

PVT11194 2 ug
EUR 301


PVT14405 2 ug
EUR 599

Anti-CFP-10 (M. tuberculosis) Purified

11-490-C025 0.025 mg
EUR 122

Anti-CFP-10 (M. tuberculosis) Purified

11-490-C100 0.1 mg
EUR 204

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

CFP Blocking Peptide

33R-8645 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CFP antibody, catalog no. 70R-5909

CFP Blocking Peptide

33R-7790 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CFP antibody, catalog no. 70R-5908

Mouse Properdin (Cfp)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Properdin(Cfp) expressed in E.coli

Mouse Properdin (Cfp)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Properdin(Cfp) expressed in Yeast

Mouse Properdin (Cfp)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Properdin(Cfp) expressed in Yeast

CFP expression Adenovirus

AVP002 1x109 IFU/ml x 200ul
EUR 349
Description: pre-made CFP expression adenovirus, provided in DMEM medium.

CFP Blocking Peptide

DF7320-BP 1mg
EUR 195

Properdin (CFP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Properdin (CFP) Antibody

abx034581-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Properdin (CFP) Antibody

abx034581-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Properdin (CFP) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

CFP Conjugated Antibody

C32828 100ul
EUR 397

CFP cloning plasmid

CSB-CL005291HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgatcacagagggagcgcaggcccctcgattgttgctgccgccgctgctcctgctgctcaccctgccagccacaggctcagaccccgtgctctgcttcacccagtatgaagaatcctccggcaagtgcaagggcctcctggggggtggtgtcagcgtggaagactgctgtctca
  • Show more
Description: A cloning plasmid for the CFP gene.

CFP Rabbit pAb

A5398-100ul 100 ul
EUR 308

CFP Rabbit pAb

A5398-200ul 200 ul
EUR 459

CFP Rabbit pAb

A5398-20ul 20 ul
EUR 183

CFP Rabbit pAb

A5398-50ul 50 ul
EUR 223

CFP Rabbit pAb

A16414-100ul 100 ul
EUR 308

CFP Rabbit pAb

A16414-200ul 200 ul
EUR 459