Beopenlab

USP44 Antibody
1-CSB-PA060300	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against USP44. Recognizes USP44 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

USP44 Antibody
DF4594	Affbiotech	200ul	EUR 304
Description: USP44 Antibody detects endogenous levels of total USP44.

USP44 Antibody
1-CSB-PA025736GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP44. Recognizes USP44 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

USP44 siRNA
20-abx939235	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP44 siRNA
20-abx939236	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP44 Antibody
ABD4594	Lifescience Market	100 ug	EUR 438

pBlueScriptR-USP44
PVT17296	Lifescience Market	2 ug	EUR 258

Anti-USP44 Antibody
A08401	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for USP44 Antibody (USP44) detection. Tested with WB in Human.

USP44 Rabbit pAb
A15528-100ul	Abclonal	100 ul	EUR 308

USP44 Rabbit pAb
A15528-200ul	Abclonal	200 ul	EUR 459

USP44 Rabbit pAb
A15528-20ul	Abclonal	20 ul	EUR 183

USP44 Rabbit pAb
A15528-50ul	Abclonal	50 ul	EUR 223

USP44 Polyclonal Antibody
41526-100ul	SAB	100ul	EUR 252

USP44 Polyclonal Antibody
41526-50ul	SAB	50ul	EUR 187

USP44 Blocking Peptide
DF4594-BP	Affbiotech	1mg	EUR 195

USP44 Blocking Peptide
20-abx161752	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

USP44 cloning plasmid
CSB-CL884431HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2139 Sequence: atgctagcaatggatacgtgcaaacatgttgggcagctgcagcttgctcaagaccattccagcctcaaccctcagaaatggcactgtgtggactgcaacacgaccgagtccatttgggcttgccttagctgctcccatgttgcctgtggaagatatattgaagagcatgcactca Show more
Description: A cloning plasmid for the USP44 gene.

USP44 Polyclonal Antibody
ABP56729-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260 Applications tips:
Description: A polyclonal antibody for detection of USP44 from Human. This USP44 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260

USP44 Polyclonal Antibody
ABP56729-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260 Applications tips:
Description: A polyclonal antibody for detection of USP44 from Human. This USP44 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260

USP44 Polyclonal Antibody
ABP56729-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260 Applications tips:
Description: A polyclonal antibody for detection of USP44 from Human. This USP44 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human USP44 at AA range: 180-260

USP44 Polyclonal Antibody
ES7728-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against USP44 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

USP44 Polyclonal Antibody
ES7728-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against USP44 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- USP44 antibody
FNab09334	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 Immunogen: ubiquitin specific peptidase 44 Uniprot ID: Q9H0E7 Gene ID: 84101 Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP44

Anti-USP44 antibody
PAab09334	Lifescience Market	100 ug	EUR 412

Anti-USP44 antibody
STJ117723	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome.

Anti-USP44 antibody
STJ96206	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to USP44.

USP44 ELISA KIT|Human
EF004141	Lifescience Market	96 Tests	EUR 689

Mouse Usp44 ELISA KIT
ELI-51361m	Lifescience Market	96 Tests	EUR 865

USP44 Polyclonal Conjugated Antibody
C41526	SAB	100ul	EUR 397

Mouse USP44 shRNA Plasmid
20-abx983494	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human USP44 shRNA Plasmid
20-abx963298	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

USP44 Recombinant Protein (Rat)
RP236120	ABM	100 ug	Ask for price

USP44 Recombinant Protein (Human)
RP034132	ABM	100 ug	Ask for price

USP44 Recombinant Protein (Mouse)
RP183455	ABM	100 ug	Ask for price

USP44 Recombinant Protein (Mouse)
RP183458	ABM	100 ug	Ask for price

Usp44 ORF Vector (Mouse) (pORF)
ORF061153	ABM	1.0 ug DNA	EUR 506

Usp44 ORF Vector (Mouse) (pORF)
ORF061154	ABM	1.0 ug DNA	EUR 506

Usp44 ORF Vector (Rat) (pORF)
ORF078708	ABM	1.0 ug DNA	EUR 506

USP44 ORF Vector (Human) (pORF)
ORF011378	ABM	1.0 ug DNA	EUR 95

Ubiquitin Specific Peptidase 44 (USP44) Antibody
20-abx116445	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Usp44 sgRNA CRISPR Lentivector set (Rat)
K6593501	ABM	3 x 1.0 ug	EUR 339

USP44 sgRNA CRISPR Lentivector set (Human)
K2601301	ABM	3 x 1.0 ug	EUR 339

Usp44 sgRNA CRISPR Lentivector set (Mouse)
K4696501	ABM	3 x 1.0 ug	EUR 339

Ubiquitin Carboxyl-Terminal Hydrolase 44 (USP44) Antibody
20-abx121920	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 44 (USP44) Antibody
abx122769-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 44 (USP44) Antibody
abx239334-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Ubiquitin carboxyl-terminal hydrolase 44 (USP44) Antibody
20-abx323969	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Usp44 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6593502	ABM	1.0 ug DNA	EUR 154

Usp44 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6593503	ABM	1.0 ug DNA	EUR 154

Usp44 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6593504	ABM	1.0 ug DNA	EUR 154

USP44 sgRNA CRISPR Lentivector (Human) (Target 1)
K2601302	ABM	1.0 ug DNA	EUR 154

USP44 sgRNA CRISPR Lentivector (Human) (Target 2)
K2601303	ABM	1.0 ug DNA	EUR 154

USP44 sgRNA CRISPR Lentivector (Human) (Target 3)
K2601304	ABM	1.0 ug DNA	EUR 154

Usp44 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4696502	ABM	1.0 ug DNA	EUR 154

Usp44 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4696503	ABM	1.0 ug DNA	EUR 154

Usp44 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4696504	ABM	1.0 ug DNA	EUR 154

USP44 Protein Vector (Mouse) (pPB-C-His)
PV244610	ABM	500 ng	EUR 1065

USP44 Protein Vector (Mouse) (pPB-N-His)
PV244611	ABM	500 ng	EUR 1065

USP44 Protein Vector (Mouse) (pPM-C-HA)
PV244612	ABM	500 ng	EUR 1065

USP44 Protein Vector (Mouse) (pPM-C-His)
PV244613	ABM	500 ng	EUR 1065

USP44 Protein Vector (Mouse) (pPB-C-His)
PV244614	ABM	500 ng	EUR 603

USP44 Protein Vector (Mouse) (pPB-N-His)
PV244615	ABM	500 ng	EUR 603

USP44 Protein Vector (Mouse) (pPM-C-HA)
PV244616	ABM	500 ng	EUR 603

USP44 Protein Vector (Mouse) (pPM-C-His)
PV244617	ABM	500 ng	EUR 603

USP44 Protein Vector (Rat) (pPB-C-His)
PV314830	ABM	500 ng	EUR 603

USP44 Protein Vector (Rat) (pPB-N-His)
PV314831	ABM	500 ng	EUR 603

USP44 Protein Vector (Rat) (pPM-C-HA)
PV314832	ABM	500 ng	EUR 603

USP44 Protein Vector (Rat) (pPM-C-His)
PV314833	ABM	500 ng	EUR 603

USP44 Protein Vector (Human) (pPB-C-His)
PV045509	ABM	500 ng	EUR 329

USP44 Protein Vector (Human) (pPB-N-His)
PV045510	ABM	500 ng	EUR 329

USP44 Protein Vector (Human) (pPM-C-HA)
PV045511	ABM	500 ng	EUR 329

USP44 Protein Vector (Human) (pPM-C-His)
PV045512	ABM	500 ng	EUR 329

Usp44 3'UTR Luciferase Stable Cell Line
TU121678	ABM	1.0 ml	Ask for price

USP44 3'UTR GFP Stable Cell Line
TU078010	ABM	1.0 ml	EUR 1394

Usp44 3'UTR GFP Stable Cell Line
TU171678	ABM	1.0 ml	Ask for price