USP26 Antibody
46292-50ul 50ul
EUR 187
USP26 Antibody
1-CSB-PA874835ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP26. Recognizes USP26 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
USP26 Antibody
1-CSB-PA874835ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP26. Recognizes USP26 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
USP26 Antibody
DF9986 200ul
EUR 304
Description: USP26 Antibody detects endogenous levels of total USP26.
USP26 antibody
70R-9740 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP26 antibody
USP26 siRNA
20-abx939200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP26 siRNA
20-abx939201
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP26 Antibody
ABD9986 100 ug
EUR 438
USP26 Blocking Peptide
33R-1999 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP26 antibody, catalog no. 70R-9740
USP26 Blocking Peptide
DF9986-BP 1mg
EUR 195
USP26 Conjugated Antibody
C46292 100ul
EUR 397
USP26 cloning plasmid
CSB-CL874835HU-10ug 10ug
EUR 877
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2742
  • Sequence: ATGGCTGCCCTATTCCTACGTGGTTTTGTCCAAATAGGGAACTGCAAGACTGGGATATCTAAGTCAAAAGAAGCATTCATTGAAGCAGTGGAAAGAAAGAAGAAAGATAGACTGGTGCTGTATTTCAAAAGTGGAAAATATAGCACTTTTCGGCTAAGTGATAATATTCAAAATG
  • Show more
Description: A cloning plasmid for the USP26 gene.
USP26 Rabbit pAb
A7999-100ul 100 ul
EUR 308
USP26 Rabbit pAb
A7999-200ul 200 ul
EUR 459
USP26 Rabbit pAb
A7999-20ul 20 ul
EUR 183
USP26 Rabbit pAb
A7999-50ul 50 ul
EUR 223
Anti-USP26 antibody
STJ110306 100 µl
EUR 277
Description: This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases and is a deubiquitinating enzyme (DUB) with His and Cys domains. It is specifically expressed in testis tissue. Mutations in this gene have been associated with Sertoli cell-only syndrome and male infertility.
Anti-USP26 (4G8)
YF-MA19482 100 ug
EUR 363
Description: Mouse monoclonal to USP26
Mouse USP26 shRNA Plasmid
20-abx979142
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP26 shRNA Plasmid
20-abx963197
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Usp26 ORF Vector (Mouse) (pORF)
ORF061131 1.0 ug DNA
EUR 506
Usp26 ORF Vector (Rat) (pORF)
ORF078692 1.0 ug DNA
EUR 506
USP26 ORF Vector (Human) (pORF)
ORF014902 1.0 ug DNA
EUR 354
pECMV-Usp26-m-FLAG Plasmid
PVT15459 2 ug
EUR 325
Rabbit Anti-Human USP26 polyclonal antibody
CABT-BL087 100 ul
EUR 585
Usp26 sgRNA CRISPR Lentivector set (Rat)
K6544501 3 x 1.0 ug
EUR 339
USP26 sgRNA CRISPR Lentivector set (Human)
K2599501 3 x 1.0 ug
EUR 339
Usp26 sgRNA CRISPR Lentivector set (Mouse)
K4054701 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx007162
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx219276
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx142303
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx320982
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx322474
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Usp26 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6544502 1.0 ug DNA
EUR 154
Usp26 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6544503 1.0 ug DNA
EUR 154
Usp26 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6544504 1.0 ug DNA
EUR 154
USP26 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599502 1.0 ug DNA
EUR 154
USP26 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599503 1.0 ug DNA
EUR 154
USP26 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599504 1.0 ug DNA
EUR 154
Usp26 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4054702 1.0 ug DNA
EUR 154
Usp26 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4054703 1.0 ug DNA
EUR 154
Usp26 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4054704 1.0 ug DNA
EUR 154
USP26 Protein Vector (Mouse) (pPB-C-His)
PV244522 500 ng
EUR 1065
USP26 Protein Vector (Mouse) (pPB-N-His)
PV244523 500 ng
EUR 1065
USP26 Protein Vector (Mouse) (pPM-C-HA)
PV244524 500 ng
EUR 1065
USP26 Protein Vector (Mouse) (pPM-C-His)
PV244525 500 ng
EUR 1065
USP26 Protein Vector (Rat) (pPB-C-His)
PV314766 500 ng
EUR 1191
USP26 Protein Vector (Rat) (pPB-N-His)
PV314767 500 ng
EUR 1191
USP26 Protein Vector (Rat) (pPM-C-HA)
PV314768 500 ng
EUR 1191
USP26 Protein Vector (Rat) (pPM-C-His)
PV314769 500 ng
EUR 1191
USP26 Protein Vector (Human) (pPB-C-His)
PV059605 500 ng
EUR 481
USP26 Protein Vector (Human) (pPB-N-His)
PV059606 500 ng
EUR 481
USP26 Protein Vector (Human) (pPM-C-HA)
PV059607 500 ng
EUR 481
USP26 Protein Vector (Human) (pPM-C-His)
PV059608 500 ng
EUR 481
Usp26 3'UTR Luciferase Stable Cell Line
TU121659 1.0 ml Ask for price
USP26 3'UTR GFP Stable Cell Line
TU077992 1.0 ml
EUR 1394
Usp26 3'UTR GFP Stable Cell Line
TU171659 1.0 ml Ask for price
Usp26 3'UTR Luciferase Stable Cell Line
TU222933 1.0 ml Ask for price
USP26 3'UTR Luciferase Stable Cell Line
TU027992 1.0 ml
EUR 1394
Usp26 3'UTR GFP Stable Cell Line
TU272933 1.0 ml Ask for price
Human Ubiquitin carboxyl- terminal hydrolase 26, USP26 ELISA KIT
ELI-17869h 96 Tests
EUR 824
Mouse Ubiquitin carboxyl- terminal hydrolase 26, Usp26 ELISA KIT
ELI-39980m 96 Tests
EUR 865
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6544505 3 x 1.0 ug
EUR 376
USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2599505 3 x 1.0 ug
EUR 376
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4054705 3 x 1.0 ug
EUR 376
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6544506 1.0 ug DNA
EUR 167
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6544507 1.0 ug DNA
EUR 167
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6544508 1.0 ug DNA
EUR 167
USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2599506 1.0 ug DNA
EUR 167
USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2599507 1.0 ug DNA
EUR 167
USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2599508 1.0 ug DNA
EUR 167
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4054706 1.0 ug DNA
EUR 167
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4054707 1.0 ug DNA
EUR 167
Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4054708 1.0 ug DNA
EUR 167