Human Uromodulin (UMOD) ELISA Kit
EUR 673
  • Should the Human Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.
Mouse Uromodulin (UMOD) ELISA Kit
EUR 527
  • Should the Mouse Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.
Mouse Uromodulin (UMOD) ELISA Kit
EUR 688
  • Should the Mouse Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.
Rat Uromodulin (UMOD) ELISA Kit
EUR 549
  • Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.
Rat Uromodulin (UMOD) ELISA Kit
EUR 718
  • Should the Rat Uromodulin (UMOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uromodulin (UMOD) in samples from serum, plasma, urine or other biological fluids.
Human Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Hu-48Tests 48 Tests
EUR 544
Human Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Hu-96Tests 96 Tests
EUR 756
Mouse Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Mu-48Tests 48 Tests
EUR 557
Mouse Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Mu-96Tests 96 Tests
EUR 774
Rat Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Ra-48Tests 48 Tests
EUR 583
Rat Uromodulin (UMOD) ELISA Kit
RDR-UMOD-Ra-96Tests 96 Tests
EUR 811
Human Uromodulin (UMOD) ELISA Kit
RD-UMOD-Hu-48Tests 48 Tests
EUR 521
Human Uromodulin (UMOD) ELISA Kit
RD-UMOD-Hu-96Tests 96 Tests
EUR 723
Mouse Uromodulin (UMOD) ELISA Kit
RD-UMOD-Mu-48Tests 48 Tests
EUR 533
Mouse Uromodulin (UMOD) ELISA Kit
RD-UMOD-Mu-96Tests 96 Tests
EUR 740
Rat Uromodulin (UMOD) ELISA Kit
RD-UMOD-Ra-48Tests 48 Tests
EUR 557
Rat Uromodulin (UMOD) ELISA Kit
RD-UMOD-Ra-96Tests 96 Tests
EUR 775
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UMOD antibody
70R-21166 50 ul
EUR 435
Description: Rabbit polyclonal UMOD antibody
UMOD antibody
70R-8504 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UMOD antibody
UMOD Antibody
ABD6692 100 ug
EUR 438
UMOD Antibody
32498-100ul 100ul
EUR 252
UMOD Antibody
DF6692 200ul
EUR 304
Description: UMOD Antibody detects endogenous levels of total UMOD.
UMOD Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
UMOD Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UMOD. Recognizes UMOD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
UMOD Conjugated Antibody
C32498 100ul
EUR 397
UMOD cloning plasmid
CSB-CL025616HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1836
  • Sequence: atggggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacctcagaagcaagatggtgctctgaatgtcacagcaatgccacctgcacggaggatgaggccgttacgacgtgcacctgtcaggagggcttcaccggcg
  • Show more
Description: A cloning plasmid for the UMOD gene.
Uromodulin (UMOD) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Uromodulin (UMOD) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uromodulin (UMOD) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Uromodulin (UMOD) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uromodulin (UMOD) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uromodulin (UMOD) Antibody
  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uromodulin (UMOD) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Uromodulin (UMOD) Antibody
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uromodulin (UMOD) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Uromodulin (UMOD) Antibody
abx433429-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Uromodulin (UMOD) Antibody
abx433430-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Uromodulin (UMOD) Antibody
abx239294-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Uromodulin (UMOD) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uromodulin (UMOD) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
UMOD Rabbit pAb
A1920-100ul 100 ul
EUR 308
UMOD Rabbit pAb
A1920-200ul 200 ul
EUR 459
UMOD Rabbit pAb
A1920-20ul 20 ul
EUR 183
UMOD Rabbit pAb
A1920-50ul 50 ul
EUR 223
UMOD Blocking Peptide
33R-7383 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UMOD antibody, catalog no. 70R-8504
UMOD Blocking Peptide
DF6692-BP 1mg
EUR 195
Mouse Uromodulin (Umod)
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 64.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uromodulin(Umod),partial expressed in Yeast
Recombinant Uromodulin (UMOD)
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q862Z3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Uromodulin expressed in: E.coli
Recombinant Uromodulin (UMOD)
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07911
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01%skl, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Uromodulin expressed in: E.coli
Recombinant Uromodulin (UMOD)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91X17
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.8kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Uromodulin expressed in: E.coli
Recombinant Uromodulin (UMOD)
  • EUR 522.91
  • EUR 243.00
  • EUR 1685.92
  • EUR 628.64
  • EUR 1157.28
  • EUR 413.00
  • EUR 4064.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27590
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Uromodulin expressed in: E.coli
Anti-UMOD antibody
STJ26043 100 µl
EUR 277
Description: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants.
Polyclonal UMOD Antibody (Center)
APR03934G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD (Center). This antibody is tested and proven to work in the following applications:
Rat UMOD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELA-E2280h 96 Tests
EUR 824
EF006268 96 Tests
EUR 689
Human Uromodulin (UMOD) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Uromodulin (UMOD) Protein
  • EUR 732.00
  • EUR 286.00
  • EUR 2277.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dog Uromodulin (UMOD) Protein
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Uromodulin (UMOD) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uromodulin (UMOD) Antibody Pair
  • EUR 1483.00
  • EUR 954.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Uromodulin (UMOD) Antibody (Biotin)
  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Uromodulin (UMOD) Antibody (Biotin)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human UMOD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UMOD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
OVA Conjugated Uromodulin (UMOD)
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07911
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Uromodulin expressed in: chemical synthesis
UMOD Uromodulin Human protein
PROTP07911 Regular: 10ug
EUR 317
Description: Uromodulin Human Native protein produced from Human Urine, is a glycosylated polypeptide chain containing 590 amino acids, having a total Mw of 64.25 kDa (excluding glycosylation).
UMOD Recombinant Protein (Human)
RP033967 100 ug Ask for price
UMOD Recombinant Protein (Rat)
RP235856 100 ug Ask for price
UMOD Recombinant Protein (Mouse)
RP183092 100 ug Ask for price
STJ150397 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of THP in Rat serum, plasma and other biological fluids
Polyclonal UMOD / Uromodulin Antibody (Val378)
APR03149G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UMOD / Uromodulin (Val378). This antibody is tested and proven to work in the following applications: