  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2D3 antibody
70R-21099 50 ul
EUR 435
Description: Rabbit polyclonal UBE2D3 antibody
UBE2D3 antibody
70R-3088 50 ug
EUR 467
Description: Rabbit polyclonal UBE2D3 antibody
UBE2D3 Antibody
ABD2261 100 ug
EUR 438
UBE2D3 Antibody
43602-100ul 100ul
EUR 252
UBE2D3 Antibody
DF2261 200ul
EUR 304
Description: UBE2D3 antibody detects endogenous levels of total UBE2D3.
UBE2D3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2D3. Recognizes UBE2D3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
UBE2D3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D3. Recognizes UBE2D3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
UBE2D3 Conjugated Antibody
C43602 100ul
EUR 397
UBE2D3 cloning plasmid
CSB-CL025445HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atggcgctgaaacggattaataaggaacttagtgatttggcccgtgaccctccagcacaatgttctgcaggtccagttggggatgatatgtttcattggcaagccacaattatgggacctaatgacagcccatatcaaggcggtgtattctttttgacaattcattttcctacaga
  • Show more
Description: A cloning plasmid for the UBE2D3 gene.
UBE2D3 cloning plasmid
CSB-CL025445HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atggcgctgaaacggattaataaggaacttagtgatttggcccgtgaccctccagcacaatgttctgcaggtccagttggggatgatatgtttcattggcaagccacaattatgggacctaatgacagcccatatcaaggcggtgtattctttttgacaattcattttcctacaga
  • Show more
Description: A cloning plasmid for the UBE2D3 gene.
anti- UBE2D3 antibody
FNab09168 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin-conjugating enzyme E2D 3
  • Uniprot ID: P61077
  • Gene ID: 7323
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2D3
UBE2D3 Rabbit pAb
A4173-100ul 100 ul
EUR 308
UBE2D3 Rabbit pAb
A4173-200ul 200 ul
EUR 459
UBE2D3 Rabbit pAb
A4173-20ul 20 ul Ask for price
UBE2D3 Rabbit pAb
A4173-50ul 50 ul Ask for price
UBE2D3 Polyclonal Antibody
A56803 100 µg
EUR 570.55
Description: Ask the seller for details
UBE2D3 Rabbit pAb
A14640-100ul 100 ul
EUR 308
UBE2D3 Rabbit pAb
A14640-200ul 200 ul
EUR 459
UBE2D3 Rabbit pAb
A14640-20ul 20 ul
EUR 183
UBE2D3 Rabbit pAb
A14640-50ul 50 ul
EUR 223
UBE2D3 Blocking Peptide
33R-5691 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2D3 antibody, catalog no. 70R-3088
Human recombinant UBE2D3
EUR 365
UBE2D3 Blocking Peptide
DF2261-BP 1mg
EUR 195
Anti-UBE2D3 antibody
PAab09168 100 ug
EUR 386
PVT18248 2 ug
EUR 231
pDEST17-UbE2D3 Plasmid
PVT14782 2 ug
EUR 325
Anti-UBE2D3 antibody
STJ26015 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase.
Anti-UBE2D3 antibody
STJ116847 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase.
Anti-UBE2D3 (S2)
YF-MA16001 100 ug
EUR 363
Description: Mouse monoclonal to UBE2D3
Mouse UBE2D3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat UBE2D3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF003995 96 Tests
EUR 689
Human UBE2D3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2D3 protein (His tag)
80R-2023 50 ug
EUR 322
Description: Recombinant human UBE2D3 protein (His tag)
UBE2D3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D3. Recognizes UBE2D3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBE2D3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D3. Recognizes UBE2D3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBE2D3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D3. Recognizes UBE2D3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
anti-UBE2D3 (4C1-1E3)
LF-MA10362 100 ug
EUR 363
Description: Mouse monoclonal to UBE2D3
Recombinant Human UBE2D3 Protein
RP00012 5 μg
EUR 149
UBE2D3 Recombinant Protein (Human)
RP033679 100 ug Ask for price
UBE2D3 Recombinant Protein (Human)
RP033682 100 ug Ask for price
UBE2D3 Recombinant Protein (Rat)
RP235535 100 ug Ask for price
UBE2D3 Recombinant Protein (Mouse)
RP182633 100 ug Ask for price
pENTR223-UBE2D3-C7G vector
PVT11844 2 ug
EUR 304
Polyclonal UBE2D3 Antibody (C-term)
APR04139G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2D3 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal UBE2D3 Antibody (C-term)
APR06941G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2D3 (C-term). This antibody is tested and proven to work in the following applications:
UBE2D3 Polyclonal Antibody, HRP Conjugated
A56804 100 µg
EUR 570.55
Description: The best epigenetics products
UBE2D3 Polyclonal Antibody, FITC Conjugated
A56805 100 µg
EUR 570.55
Description: kits suitable for this type of research
UBE2D3 Polyclonal Antibody, Biotin Conjugated
A56806 100 µg
EUR 570.55
Description: fast delivery possible
Ube2d3 ORF Vector (Rat) (pORF)
ORF078513 1.0 ug DNA
EUR 506
UBE2D3 ORF Vector (Human) (pORF)
ORF011227 1.0 ug DNA
EUR 95
UBE2D3 ORF Vector (Human) (pORF)
ORF011228 1.0 ug DNA
EUR 95
Ube2d3 ORF Vector (Mouse) (pORF)
ORF060879 1.0 ug DNA
EUR 506
UBE2D3 sgRNA CRISPR Lentivector set (Human)
K2571001 3 x 1.0 ug
EUR 339
Ube2d3 sgRNA CRISPR Lentivector set (Mouse)
K4819701 3 x 1.0 ug
EUR 339
Ube2d3 sgRNA CRISPR Lentivector set (Rat)
K7598001 3 x 1.0 ug
EUR 339
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
abx029075-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
abx029075-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
abx340119-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D3 (UBE2D3) Antibody
abx239168-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
UBE2D3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2571002 1.0 ug DNA
EUR 154
UBE2D3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2571003 1.0 ug DNA
EUR 154
UBE2D3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2571004 1.0 ug DNA
EUR 154
Human Ubiquitin-conjugating enzyme E2 D3 (UBE2D3)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-conjugating enzyme E2 D3(UBE2D3) expressed in E.coli
Ube2d3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4819702 1.0 ug DNA
EUR 154
Ube2d3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4819703 1.0 ug DNA
EUR 154
Ube2d3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4819704 1.0 ug DNA
EUR 154
Ube2d3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7598002 1.0 ug DNA
EUR 154
Ube2d3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7598003 1.0 ug DNA
EUR 154