Human Ubiquitin Conjugating Enzyme E2A (UBE2A) ELISA Kit
DLR-UBE2A-Hu-96T 96T
EUR 647
  • Should the Human Ubiquitin Conjugating Enzyme E2A (UBE2A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Conjugating Enzyme E2A (UBE2A) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Ubiquitin Conjugating Enzyme E2A (UBE2A) ELISA Kit
RDR-UBE2A-Hu-48Tests 48 Tests
EUR 522
Human Ubiquitin Conjugating Enzyme E2A (UBE2A) ELISA Kit
RDR-UBE2A-Hu-96Tests 96 Tests
EUR 724
Human Ubiquitin Conjugating Enzyme E2A (UBE2A) ELISA Kit
RD-UBE2A-Hu-48Tests 48 Tests
EUR 500
Human Ubiquitin Conjugating Enzyme E2A (UBE2A) ELISA Kit
RD-UBE2A-Hu-96Tests 96 Tests
EUR 692
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2A antibody
70R-21095 50 ul
EUR 435
Description: Rabbit polyclonal UBE2A antibody
UBE2A Antibody
47278-100ul 100ul
EUR 252
UBE2A antibody
10R-1387 100 ug
EUR 512
Description: Mouse monoclonal UBE2A antibody
UBE2A Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2A. Recognizes UBE2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
UBE2A Conjugated Antibody
C47278 100ul
EUR 397
UBE2A cloning plasmid
CSB-CL025438HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atgtccaccccggctcggcggcgcctcatgcgggacttcaagaggttgcaggaggatcctccagccggagtcagcggggctccgtccgagaacaacataatggtgtggaacgcggtcattttcgggcctgaagggaccccgtttgaggatggaacatttaaacttacaatagaatt
  • Show more
Description: A cloning plasmid for the UBE2A gene.
anti- UBE2A antibody
FNab09163 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ubiquitin-conjugating enzyme E2A (RAD6 homolog)
  • Uniprot ID: P49459
  • Gene ID: 7319
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism
Description: Antibody raised against UBE2A
UBE2A / B Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
UBE2A/B Antibody
ABD9999 100 ug
EUR 438
UBE2A / UBE2B Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBE2A / B Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBE2A/B antibody
70R-50522 100 ul
EUR 244
Description: Purified Polyclonal UBE2A/B antibody
UBE2A Rabbit pAb
A12528-100ul 100 ul
EUR 308
UBE2A Rabbit pAb
A12528-200ul 200 ul
EUR 459
UBE2A Rabbit pAb
A12528-20ul 20 ul
EUR 183
UBE2A Rabbit pAb
A12528-50ul 50 ul
EUR 223
UBE2A Rabbit pAb
A7744-100ul 100 ul
EUR 308
UBE2A Rabbit pAb
A7744-200ul 200 ul
EUR 459
UBE2A Rabbit pAb
A7744-20ul 20 ul
EUR 183
UBE2A Rabbit pAb
A7744-50ul 50 ul
EUR 223
UBE2A/B Antibody
46299-100ul 100ul
EUR 252
UBE2A/B Antibody
46299-50ul 50ul
EUR 187
UBE2A/B Antibody
DF9999 200ul
EUR 304
Description: UBE2A/B Antibody detects endogenous levels of total UBE2A/B.
UBE2A/UBE2B Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBE2A/UBE2B. Recognizes UBE2A/UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
Anti-UBE2A antibody
PAab09163 100 ug
EUR 386
Anti-UBE2A antibody
STJ110055 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with mental retardation. Alternative splicing results in multiple transcript variants.
Anti-UBE2A antibody
STJ114402 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with mental retardation. Alternative splicing results in multiple transcript variants.
UBE2A/B Conjugated Antibody
C46299 100ul
EUR 397
Polyclonal UBE2A/B Antibody
APR05569G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2A/B . This antibody is tested and proven to work in the following applications:
ELA-E0991h 96 Tests
EUR 824
EF001715 96 Tests
EUR 689
UBE2A/B Polyclonal Antibody
ES3811-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBE2A/B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
UBE2A/B Polyclonal Antibody
ES3811-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2A/B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
UBE2A/B Polyclonal Antibody
ABP52812-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBE2A/B
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2A/B from Human, Mouse, Rat. This UBE2A/B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBE2A/B
UBE2A/B Polyclonal Antibody
ABP52812-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBE2A/B
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2A/B from Human, Mouse, Rat. This UBE2A/B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBE2A/B
UBE2A/B Polyclonal Antibody
ABP52812-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBE2A/B
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2A/B from Human, Mouse, Rat. This UBE2A/B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBE2A/B
UBE2A / B Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Human UBE2A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-UBE2A/B Antibody
A05264 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for UBE2A/B Antibody (UBE2A) detection.tested for IHC, WB in Human, Mouse, Rat.
UBE2A protein (His tag)
80R-1319 100 ug
EUR 268
Description: Purified recombinant Human UBE2A protein
UBE2A/B Blocking Peptide
DF9999-BP 1mg
EUR 195
Mouse UBE2A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2A Recombinant Protein (Human)
RP033667 100 ug Ask for price
UBE2A Recombinant Protein (Rat)
RP235517 100 ug Ask for price
UBE2A Recombinant Protein (Mouse)
RP182615 100 ug Ask for price
Anti-UBE2A/B antibody
STJ96446 200 µl
EUR 197
Description: Rabbit polyclonal to UBE2A/B.
Ube2a ORF Vector (Rat) (pORF)
ORF078507 1.0 ug DNA
EUR 506
UBE2A ORF Vector (Human) (pORF)
ORF011223 1.0 ug DNA
EUR 95
Ube2a ORF Vector (Mouse) (pORF)
ORF060873 1.0 ug DNA
EUR 506
UBE2A ELISA Kit (Human) (OKEH04399)
OKEH04399 96 Wells
EUR 662
Description: Description of target: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with mental retardation. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL
UBE2A ELISA Kit (Mouse) (OKEH04400)
OKEH04400 96 Wells
EUR 662
Description: Description of target: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In association with the E3 enzyme BRE1 (RNF20 and/or RNF40), it plays a role in transcription regulation by catalyzing the monoubiquitination of histone H2B at 'Lys-120' to form H2BK120ub1. H2BK120ub1 gives a specific tag for epigenetic transcriptional activation, elongation by RNA polymerase II, telomeric silencing, and is also a prerequisite for H3K4me and H3K79me formation. In vitro catalyzes 'Lys-11', as well as 'Lys-48'-linked polyubiquitination. Required for postreplication repair of UV-damaged DNA.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL
Ubiquitin Conjugating Enzyme E2A (UBE2A) Antibody
abx145292-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Conjugating Enzyme E2A (UBE2A) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Conjugating Enzyme E2A (UBE2A) Antibody
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Ubiquitin Conjugating Enzyme E2A (UBE2A) Antibody
abx239163-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ubiquitin Conjugating Enzyme E2A (UBE2A) Antibody
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Ubiquitin Conjugating Enzyme E2A (UBE2A) Antibody
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
UBE2A sgRNA CRISPR Lentivector set (Human)
K2570301 3 x 1.0 ug
EUR 339
Ube2a sgRNA CRISPR Lentivector set (Mouse)
K3379201 3 x 1.0 ug
EUR 339
Ube2a sgRNA CRISPR Lentivector set (Rat)
K7568101 3 x 1.0 ug
EUR 339
Human Ubiquitin Conjugating Enzyme E2A (UBE2A) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Ubiquitin Conjugating Enzyme E2A (UBE2A) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
UBE2A sgRNA CRISPR Lentivector (Human) (Target 1)
K2570302 1.0 ug DNA
EUR 154
UBE2A sgRNA CRISPR Lentivector (Human) (Target 2)
K2570303 1.0 ug DNA
EUR 154
UBE2A sgRNA CRISPR Lentivector (Human) (Target 3)
K2570304 1.0 ug DNA
EUR 154
Ube2a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3379202 1.0 ug DNA
EUR 154
Ube2a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3379203 1.0 ug DNA
EUR 154
Ube2a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3379204 1.0 ug DNA
EUR 154