TUBA1B siRNA
20-abx905864
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA1B siRNA
20-abx938541
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA1B siRNA
20-abx938542
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA1B antibody
70R-21056 50 ul
EUR 435
Description: Rabbit polyclonal TUBA1B antibody
TUBA1B Antibody
ABD7995 100 ug
EUR 438
TUBA1B Antibody
45195-100ul 100ul
EUR 252
TUBA1B Antibody
45195-50ul 50ul
EUR 187
TUBA1B Antibody
47230-100ul 100ul
EUR 252
TUBA1B Antibody
DF7995 200ul
EUR 304
Description: TUBA1B Antibody detects endogenous levels of total TUBA1B.
TUBA1B Antibody
CSB-PA910224-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
TUBA1B Antibody
CSB-PA910224-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
TUBA1B Antibody
1-CSB-PA04189A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
TUBA1B Antibody
1-CSB-PA025307GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
pOTB7-TUBA1B
PVT18409 2 ug
EUR 231
anti-TUBA1B
YF-PA16908 100 ug
EUR 403
Description: Rabbit polyclonal to TUBA1B
anti-TUBA1B
YF-PA25560 50 ul
EUR 334
Description: Mouse polyclonal to TUBA1B
anti-TUBA1B
YF-PA25561 50 ul
EUR 334
Description: Mouse polyclonal to TUBA1B
TUBA1B Conjugated Antibody
C45195 100ul
EUR 397
TUBA1B Conjugated Antibody
C47230 100ul
EUR 397
TUBA1B cloning plasmid
CSB-CL025307HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg
  • Show more
Description: A cloning plasmid for the TUBA1B gene.
TUBA1B cloning plasmid
CSB-CL025307HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg
  • Show more
Description: A cloning plasmid for the TUBA1B gene.
TUBA1B cloning plasmid
CSB-CL025307HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg
  • Show more
Description: A cloning plasmid for the TUBA1B gene.
TUBA1B cloning plasmid
CSB-CL025307HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg
  • Show more
Description: A cloning plasmid for the TUBA1B gene.
TUBA1B cloning plasmid
CSB-CL025307HU5-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg
  • Show more
Description: A cloning plasmid for the TUBA1B gene.
TUBA1A / TUBA1B Antibody
20-abx327000
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B Antibody
20-abx328602
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B Antibody
20-abx329649
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1B Blocking Peptide
DF7995-BP 1mg
EUR 195
TUBA1A/TUBA1B Antibody
1-CSB-PA000353
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000
TUBA1A/TUBA1B Antibody
1-CSB-PA004344
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000
TUBA1A/TUBA1B Antibody
1-CSB-PA004665
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.03% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
pOTB7-TUBA1B-2
PVT18885 2 ug
EUR 231
pCMV-SPORT6-TUBA1B
PVT12924 2 ug
EUR 391
Anti-TUBA1B (2E8)
YF-MA17275 100 ug
EUR 363
Description: Mouse monoclonal to TUBA1B
Anti-TUBA1B (4D1)
YF-MA11275 100 ug
EUR 363
Description: Mouse monoclonal to TUBA1B
TUBA1B ELISA KIT|Human
EF007493 96 Tests
EUR 689
Human TUBA1B shRNA Plasmid
20-abx957029
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TUBA1B shRNA Plasmid
20-abx973253
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TUBA1B shRNA Plasmid
20-abx991008
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TUBA1B Antibody, HRP conjugated
1-CSB-PA04189B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TUBA1B Antibody, FITC conjugated
1-CSB-PA04189C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TUBA1B Antibody, Biotin conjugated
1-CSB-PA04189D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TUBA1B Recombinant Protein (Human)
RP033394 100 ug Ask for price
TUBA1B Recombinant Protein (Human)
RP033397 100 ug Ask for price
TUBA1B Recombinant Protein (Human)
RP033400 100 ug Ask for price
TUBA1B Recombinant Protein (Human)
RP033403 100 ug Ask for price
TUBA1B Recombinant Protein (Human)
RP033406 100 ug Ask for price
TUBA1B Recombinant Protein (Rat)
RP235253 100 ug Ask for price
TUBA1B Recombinant Protein (Mouse)
RP182213 100 ug Ask for price
Tubulin, Alpha 1B (TUBA1B) Antibody
20-abx116345
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
h TUBA1B inducible lentiviral particles
LVP096 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TUBA1B, is fully sequence verified and matched to NCBI accession ID: NM_006082
Tuba1b ORF Vector (Rat) (pORF)
ORF078419 1.0 ug DNA
EUR 506
TUBA1B ORF Vector (Human) (pORF)
ORF011132 1.0 ug DNA
EUR 95
TUBA1B ORF Vector (Human) (pORF)
ORF011133 1.0 ug DNA
EUR 95
TUBA1B ORF Vector (Human) (pORF)
ORF011134 1.0 ug DNA
EUR 95
TUBA1B ORF Vector (Human) (pORF)
ORF011135 1.0 ug DNA
EUR 95
TUBA1B ORF Vector (Human) (pORF)
ORF011136 1.0 ug DNA
EUR 95
Tuba1b ORF Vector (Mouse) (pORF)
ORF060739 1.0 ug DNA
EUR 506
Tubulin Alpha-1B Chain (TUBA1B) Antibody
abx145795-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Acetyl-TUBA1A / TUBA1B / TUBA1C (K112) Antibody
20-abx327430
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA4A Antibody
20-abx327431
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha-1B Chain (TUBA1B) Antibody
20-abx219166
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha-1B Chain (TUBA1B) Antibody
abx332193-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Tubulin Alpha-1B Chain (TUBA1B) Antibody
20-abx318708
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1B sgRNA CRISPR Lentivector set (Human)
K2557201 3 x 1.0 ug
EUR 339
Tuba1b sgRNA CRISPR Lentivector set (Mouse)
K4755001 3 x 1.0 ug
EUR 339
Acetyl-TUBA1A/TUBA1B/TUBA1C (K112) Antibody
1-CSB-PA000134
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-TUBA1A/TUBA1B/TUBA1C (K112). Recognizes Acetyl-TUBA1A/TUBA1B/TUBA1C (K112) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A Antibody
1-CSB-PA005736
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Tuba1b sgRNA CRISPR Lentivector set (Rat)
K6743901 3 x 1.0 ug
EUR 339
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA3E / TUBA4A Antibody
20-abx327137
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha-1B Chain (TUBA1B) Antibody (HRP)
20-abx313203
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha-1B Chain (TUBA1B) Antibody (FITC)
20-abx313204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha-1B Chain (TUBA1B) Antibody (Biotin)
20-abx313205
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA8 / TUBA4A Antibody
20-abx329824
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1B sgRNA CRISPR Lentivector (Human) (Target 1)
K2557202 1.0 ug DNA
EUR 154