Beopenlab

TUBA1B antibody
70R-21056	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TUBA1B antibody

TUBA1B Antibody
47230-100ul	SAB	100ul	EUR 252

TUBA1B Antibody
45195-100ul	SAB	100ul	EUR 252

TUBA1B Antibody
45195-50ul	SAB	50ul	EUR 187

TUBA1B Antibody
CSB-PA910224-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TUBA1B Antibody
CSB-PA910224-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TUBA1B Antibody
DF7995	Affbiotech	200ul	EUR 304
Description: TUBA1B Antibody detects endogenous levels of total TUBA1B.

TUBA1B Antibody
1-CSB-PA04189A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TUBA1B Antibody
1-CSB-PA025307GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TUBA1B siRNA
20-abx905864	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBA1B siRNA
20-abx938541	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBA1B siRNA
20-abx938542	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBA1B Antibody
ABD7995	Lifescience Market	100 ug	EUR 438

pOTB7-TUBA1B
PVT18409	Lifescience Market	2 ug	EUR 231

anti-TUBA1B
YF-PA16908	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TUBA1B

anti-TUBA1B
YF-PA25560	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TUBA1B

anti-TUBA1B
YF-PA25561	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TUBA1B

TUBA1A/TUBA1B Antibody
1-CSB-PA004344	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

TUBA1A/TUBA1B Antibody
1-CSB-PA004665	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.03% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

TUBA1A/TUBA1B Antibody
1-CSB-PA000353	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000

TUBA1B Blocking Peptide
DF7995-BP	Affbiotech	1mg	EUR 195

TUBA1B Conjugated Antibody
C45195	SAB	100ul	EUR 397

TUBA1B Conjugated Antibody
C47230	SAB	100ul	EUR 397

TUBA1A / TUBA1B Antibody
20-abx329649	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TUBA1A / TUBA1B Antibody
20-abx327000	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TUBA1A / TUBA1B Antibody
20-abx328602	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TUBA1B cloning plasmid
CSB-CL025307HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1356 Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg Show more
Description: A cloning plasmid for the TUBA1B gene.

TUBA1B cloning plasmid
CSB-CL025307HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1356 Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg Show more
Description: A cloning plasmid for the TUBA1B gene.

TUBA1B cloning plasmid
CSB-CL025307HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1356 Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg Show more
Description: A cloning plasmid for the TUBA1B gene.

TUBA1B cloning plasmid
CSB-CL025307HU4-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1008 Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg Show more
Description: A cloning plasmid for the TUBA1B gene.

TUBA1B cloning plasmid
CSB-CL025307HU5-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1356 Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctg Show more
Description: A cloning plasmid for the TUBA1B gene.

pCMV-SPORT6-TUBA1B
PVT12924	Lifescience Market	2 ug	EUR 391

pOTB7-TUBA1B-2
PVT18885	Lifescience Market	2 ug	EUR 231

Anti-TUBA1B (4D1)
YF-MA11275	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TUBA1B

Anti-TUBA1B (2E8)
YF-MA17275	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TUBA1B

TUBA1B Antibody, HRP conjugated
1-CSB-PA04189B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBA1B Antibody, FITC conjugated
1-CSB-PA04189C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBA1B Antibody, Biotin conjugated
1-CSB-PA04189D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1B. Recognizes TUBA1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TUBA1B ELISA KIT|Human
EF007493	Lifescience Market	96 Tests	EUR 689

Rat TUBA1B shRNA Plasmid
20-abx991008	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TUBA1B shRNA Plasmid
20-abx973253	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TUBA1B shRNA Plasmid
20-abx957029	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TUBA1B Recombinant Protein (Rat)
RP235253	ABM	100 ug	Ask for price

TUBA1B Recombinant Protein (Human)
RP033394	ABM	100 ug	Ask for price

TUBA1B Recombinant Protein (Human)
RP033397	ABM	100 ug	Ask for price

TUBA1B Recombinant Protein (Human)
RP033400	ABM	100 ug	Ask for price

TUBA1B Recombinant Protein (Human)
RP033403	ABM	100 ug	Ask for price

TUBA1B Recombinant Protein (Human)
RP033406	ABM	100 ug	Ask for price

TUBA1B Recombinant Protein (Mouse)
RP182213	ABM	100 ug	Ask for price

Tubulin, Alpha 1B (TUBA1B) Antibody
20-abx116345	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tuba1b ORF Vector (Rat) (pORF)
ORF078419	ABM	1.0 ug DNA	EUR 506

h TUBA1B inducible lentiviral particles
LVP096	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TUBA1B, is fully sequence verified and matched to NCBI accession ID: NM_006082

TUBA1B ORF Vector (Human) (pORF)
ORF011132	ABM	1.0 ug DNA	EUR 95

TUBA1B ORF Vector (Human) (pORF)
ORF011133	ABM	1.0 ug DNA	EUR 95

TUBA1B ORF Vector (Human) (pORF)
ORF011134	ABM	1.0 ug DNA	EUR 95

TUBA1B ORF Vector (Human) (pORF)
ORF011135	ABM	1.0 ug DNA	EUR 95

TUBA1B ORF Vector (Human) (pORF)
ORF011136	ABM	1.0 ug DNA	EUR 95

Tuba1b ORF Vector (Mouse) (pORF)
ORF060739	ABM	1.0 ug DNA	EUR 506

TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A Antibody
1-CSB-PA005736	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Acetyl-TUBA1A/TUBA1B/TUBA1C (K112) Antibody
1-CSB-PA000134	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-TUBA1A/TUBA1B/TUBA1C (K112). Recognizes Acetyl-TUBA1A/TUBA1B/TUBA1C (K112) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Tubulin Alpha-1B Chain (TUBA1B) Antibody
20-abx219166	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Alpha-1B Chain (TUBA1B) Antibody
abx145795-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tubulin Alpha-1B Chain (TUBA1B) Antibody
20-abx318708	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Alpha-1B Chain (TUBA1B) Antibody
abx332193-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Acetyl-TUBA1A / TUBA1B / TUBA1C (K112) Antibody
20-abx327430	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA4A Antibody
20-abx327431	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tuba1b sgRNA CRISPR Lentivector set (Mouse)
K4755001	ABM	3 x 1.0 ug	EUR 339

Tuba1b sgRNA CRISPR Lentivector set (Rat)
K6743901	ABM	3 x 1.0 ug	EUR 339

TUBA1B sgRNA CRISPR Lentivector set (Human)
K2557201	ABM	3 x 1.0 ug	EUR 339

TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA3E/TUBA4A Antibody
1-CSB-PA060126	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA3E/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA3E/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA8/TUBA4A Antibody
1-CSB-PA193238	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA8/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA8/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA8 / TUBA4A Antibody
20-abx329824	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA3E / TUBA4A Antibody
20-abx327137	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Alpha-1B Chain (TUBA1B) Antibody (HRP)
20-abx313203	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Alpha-1B Chain (TUBA1B) Antibody (FITC)
20-abx313204	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.