TRAF2 Antibody
24373-100ul 100ul
EUR 390
TRAF2 Antibody
32094-100ul 100ul
EUR 252
TRAF2 Antibody
49161-100ul 100ul
EUR 333
TRAF2 Antibody
49161-50ul 50ul
EUR 239
TRAF2 Antibody
1-CSB-PA004323
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
TRAF2 Antibody
DF4767 200ul
EUR 304
Description: TRAF2 Antibody detects endogenous levels of total TRAF2.
TRAF2 Antibody
DF6146 200ul
EUR 304
Description: TRAF2 Antibody detects endogenous levels of total TRAF2.
TRAF2 Antibody
1-CSB-PA034758
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
TRAF2 Antibody
AF5382 200ul
EUR 304
Description: TRAF2 Antibody detects endogenous levels of total TRAF2.
TRAF2 Antibody
CSB-PA024147KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
TRAF2 Antibody
CSB-PA024147KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
TRAF2 Antibody
1-CSB-PA024147LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
TRAF2 siRNA
20-abx937904
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF2 siRNA
20-abx937905
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF2 Antibody
AF7863 200ul
EUR 376
Description: TRAF2 Antibody detects endogenous levels of TRAF2.
TRAF2 Antibody
ABF5382 100 ug
EUR 438
TRAF2 Antibody
ABD4767 100 ug
EUR 438
TRAF2 Antibody
ABD6146 100 ug
EUR 438
TRAF2 antibody
PAab10115 100 ug
EUR 386
anti-TRAF2
YF-PA15118 50 ul
EUR 363
Description: Mouse polyclonal to TRAF2
anti-TRAF2
YF-PA15119 50 ug
EUR 363
Description: Mouse polyclonal to TRAF2
anti-TRAF2
YF-PA15120 100 ug
EUR 403
Description: Rabbit polyclonal to TRAF2
anti-TRAF2
YF-PA24893 50 ul
EUR 334
Description: Mouse polyclonal to TRAF2
anti-TRAF2
YF-PA27390 100 ul
EUR 403
Description: Rabbit polyclonal to TRAF2
TRAF2 Blocking Peptide
DF4767-BP 1mg
EUR 195
TRAF2 Blocking Peptide
DF6146-BP 1mg
EUR 195
TRAF2 Conjugated Antibody
C49161 100ul
EUR 397
TRAF2 Blocking Peptide
AF5382-BP 1mg
EUR 195
TRAF2 Conjugated Antibody
C32094 100ul
EUR 397
Polyclonal TRAF2 Antibody
APR06381G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF2 . This antibody is tested and proven to work in the following applications:
Polyclonal TRAF2 Antibody
APR06382G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF2 . This antibody is tested and proven to work in the following applications:
TRAF2 Antibody (HRP)
20-abx313164
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAF2 Antibody (FITC)
20-abx313165
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAF2 Antibody (Biotin)
20-abx313166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAF2 cloning plasmid
CSB-CL024147HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggctgcagctagcgtgaccccccctggctccctggagttgctacagcccggcttctccaagaccctcctggggaccaagctggaagccaagtacctgtgctccgcctgcagaaacgtcctccgcaggcccttccaggcgcagtgtggccaccggtactgctccttctgcctgg
  • Show more
Description: A cloning plasmid for the TRAF2 gene.
TRAF2 Blocking Peptide
AF7863-BP 1mg
EUR 195
TRAF2 Polyclonal Antibody
ABP52635-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF2
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF2 from Human. This TRAF2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF2
TRAF2 Polyclonal Antibody
ABP52635-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF2
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF2 from Human. This TRAF2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF2
TRAF2 Polyclonal Antibody
ABP52635-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF2
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF2 from Human. This TRAF2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF2
TRAF2 Polyclonal Antibody
ES3634-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRAF2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TRAF2 Polyclonal Antibody
ES3634-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAF2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
anti- TRAF2 antibody
FNab10115 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: TNF receptor-associated factor 2
  • Uniprot ID: Q12933
  • Gene ID: 7186
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against TRAF2
Anti-TRAF2 Antibody
PA2007 100ug/vial
EUR 334
Recombinant Human TRAF2
P0303 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q12933
Description: Recombinant Human protein for TRAF2
Anti-TRAF2 Antibody
PB9516 100ug/vial
EUR 334
pCDNA3.1-HA-TRAF2
PVT19151 2 ug
EUR 258
Anti-TRAF2 antibody
STJ25951 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined.
Anti-TRAF2 antibody
STJ96082 200 µl
EUR 197
Description: Rabbit polyclonal to TRAF2.
Anti-TRAF2 antibody
STJ70887 100 µg
EUR 359
Anti-TRAF2 (4C11)
YF-MA15937 100 ug
EUR 363
Description: Mouse monoclonal to TRAF2
Anti-TRAF2 (4C11)
YF-MA15938 200 ul
EUR 363
Description: Mouse monoclonal to TRAF2
TRAF2 (Phospho-Thr22) Antibody
13210-100ul 100ul
EUR 252
TRAF2 (Phospho-Thr22) Antibody
13210-50ul 50ul
EUR 187
Phospho-TRAF2 (Ser11) Antibody
AF2428 200ul
EUR 304
Description: Phospho-TRAF2 (Ser11) Antibody detects endogenous levels of TRAF2.
Phospho-TRAF2 (Thr22) Antibody
AF7363 200ul
EUR 376
Description: Phospho-TRAF2 (Thr22) Antibody detects endogenous levels of TRAF2 only when phosphorylated at Thr22.
Mouse TRAF2 shRNA Plasmid
20-abx973206
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRAF2 Antibody, HRP conjugated
1-CSB-PA024147LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TRAF2 Antibody, FITC conjugated
1-CSB-PA024147LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TRAF2 Antibody, Biotin conjugated
1-CSB-PA024147LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAF2. Recognizes TRAF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human TRAF2 shRNA Plasmid
20-abx954935
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Phospho- TRAF2 (Ser11) Antibody
ABF3784 100 ug
EUR 438
TRAF2 recombinant monoclonal antibody
A5445 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TRAF2 for WB,ELISA
TRAF2 Recombinant Protein (Rat)
RP234491 100 ug Ask for price
pLVX-Puro-TRAF2 Plasmid
PVTB00712-4a 2 ug
EUR 356
pCMV-SPORT6-TRAF2 Plasmid
PVT16893 2 ug
EUR 325
TRAF2 Recombinant Protein (Human)
RP032755 100 ug Ask for price
TRAF2 Recombinant Protein (Mouse)
RP180830 100 ug Ask for price
[KO Validated] TRAF2 Rabbit pAb
A0962-100ul 100 ul
EUR 410
[KO Validated] TRAF2 Rabbit pAb
A0962-200ul 200 ul
EUR 571
[KO Validated] TRAF2 Rabbit pAb
A0962-20ul 20 ul
EUR 221
[KO Validated] TRAF2 Rabbit pAb
A0962-50ul 50 ul
EUR 287
Polyclonal TRAF2 Antibody (N-Terminus)
APR02392G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF2 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-TRAF2 Antibody
APG00345G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TRAF2 . This antibody is tested and proven to work in the following applications:
Phospho-TRAF2 (Ser11) Blocking Peptide
AF2428-BP 1mg
EUR 195
Polyclonal TRAF2 Antibody (C-Terminus)
APG01117G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRAF2 (C-Terminus). This antibody is tested and proven to work in the following applications: