Human Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
DLR-TGFbR2-Hu-96T 96T
EUR 599
  • Should the Human Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transforming Growth Factor Beta Receptor II (TGFbR2) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
DLR-TGFbR2-Mu-48T 48T
EUR 474
  • Should the Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
DLR-TGFbR2-Mu-96T 96T
EUR 614
  • Should the Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RDR-TGFbR2-Hu-48Tests 48 Tests
EUR 481
Human Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RDR-TGFbR2-Hu-96Tests 96 Tests
EUR 665
Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RDR-TGFbR2-Mu-48Tests 48 Tests
EUR 493
Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RDR-TGFbR2-Mu-96Tests 96 Tests
EUR 683
Human Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RD-TGFbR2-Hu-48Tests 48 Tests
EUR 460
Human Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RD-TGFbR2-Hu-96Tests 96 Tests
EUR 636
Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RD-TGFbR2-Mu-48Tests 48 Tests
EUR 472
Mouse Transforming Growth Factor Beta Receptor II (TGFbR2) ELISA Kit
RD-TGFbR2-Mu-96Tests 96 Tests
EUR 653
TGFBR2 antibody
70R-1848 100 ug
EUR 377
Description: Rabbit polyclonal TGFBR2 antibody
TGFBR2 Antibody
32275-100ul 100ul
EUR 252
TGFBR2 Antibody
1-CSB-PA004277
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
TGFBR2 Antibody
1-CSB-PA004278
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
TGFBR2 Antibody
CSB-PA120767-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Affinity-chromatography
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000
TGFBR2 Antibody
CSB-PA120767-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Affinity-chromatography
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000
TGFBR2 Antibody
CSB-PA782688-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TGFBR2 Antibody
CSB-PA782688-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TGFBR2 Antibody
DF6409 200ul
EUR 304
Description: TGFBR2 Antibody detects endogenous levels of total TGFBR2.
TGFBR2 antibody
70R-35906 100 ug
EUR 327
Description: Rabbit polyclonal TGFBR2 antibody
TGFBR2 antibody
70R-50477 100 ul
EUR 244
Description: Purified Polyclonal TGFBR2 antibody
TGFBR2 antibody
70R-51655 100 ul
EUR 287
Description: Purified Polyclonal TGFBR2 antibody
TGFBR2 Antibody
AF5449 200ul
EUR 304
Description: TGFBR2 Antibody detects endogenous levels of total TGFBR2.
TGFBR2 Antibody
1-CSB-PA023452LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
TGFBR2 siRNA
20-abx905547
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFBR2 siRNA
20-abx936624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFBR2 siRNA
20-abx936625
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFBR2 Antibody
ABF5449 100 ug
EUR 438
TGFBR2 Antibody
ABD6409 100 ug
EUR 438
pMD18-TGFBR2
PVT13744 2 ug
EUR 391
TGFBR2 Rabbit pAb
A11765-100ul 100 ul
EUR 308
TGFBR2 Rabbit pAb
A11765-200ul 200 ul
EUR 459
TGFBR2 Rabbit pAb
A11765-20ul 20 ul
EUR 183
TGFBR2 Rabbit pAb
A11765-50ul 50 ul
EUR 223
TGFBR2 Rabbit pAb
A11788-100ul 100 ul
EUR 308
TGFBR2 Rabbit pAb
A11788-200ul 200 ul
EUR 459
TGFBR2 Rabbit pAb
A11788-20ul 20 ul
EUR 183
TGFBR2 Rabbit pAb
A11788-50ul 50 ul
EUR 223
TGFBR2 Rabbit pAb
A1415-100ul 100 ul
EUR 308
TGFBR2 Rabbit pAb
A1415-200ul 200 ul
EUR 459
TGFBR2 Rabbit pAb
A1415-20ul 20 ul
EUR 183
TGFBR2 Rabbit pAb
A1415-50ul 50 ul
EUR 223
TGFBR2 Blocking Peptide
33R-6065 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGFBR2 antibody, catalog no. 70R-1848
Human TGFBR2 Antibody
32670-05111 150 ug
EUR 261
TGFBR2 Blocking Peptide
DF6409-BP 1mg
EUR 195
TGFBR2 (pY284) Antibody
abx218957-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
TGFBR2 (pS225) Antibody
20-abx134648
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
TGFBR2 Blocking Peptide
20-abx061149
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TGFBR2 Blocking Peptide
20-abx063352
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TGFBR2 Blocking Peptide
AF5449-BP 1mg
EUR 195
TGFBR2 cloning plasmid
CSB-CL023452HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1005
  • Sequence: atgggtcgggggctgctcaggggcctgtggccgctgcacatcgtcctgtggacgcgtatcgccagcacgatcccaccgcacgttcagaagtcggttaataacgacatgatagtcactgacaacaacggtgcagtcaagtttccacaactgtgtaaattttgtgatgtgagatttt
  • Show more
Description: A cloning plasmid for the TGFBR2 gene.
anti- TGFBR2 antibody
FNab08644 100µg
EUR 585
  • Immunogen: transforming growth factor, beta receptor II(70/80kDa)
  • Uniprot ID: P37173
  • Gene ID: 7048
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology
Description: Antibody raised against TGFBR2
Anti-TGFBR2 antibody
PAab08644 100 ug
EUR 412
Anti-TGFBR2 antibody
STJ26170 100 µl
EUR 277
Description: This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized.
Anti-TGFBR2 antibody
STJ113352 100 µl
EUR 277
Description: This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized.
Anti-TGFBR2 antibody
STJ113371 100 µl
EUR 277
Description: This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized.
TGFBR2 (Phospho-Tyr284) Antibody
12534-100ul 100ul
EUR 252
TGFBR2 (Phospho-Tyr284) Antibody
12534-50ul 50ul
EUR 187
Phospho-TGFBR2 (S225) Antibody
1-CSB-PA050249
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TGFBR2 (S225). Recognizes Phospho-TGFBR2 (S225) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
TGFBR2 antibody (Ser225/250)
70R-36861 100 ug
EUR 327
Description: Rabbit Polyclonal TGFBR2 antibody (Ser225/250)
TGFBR2 (pS225) Blocking Peptide
20-abx162198
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TGFBR2 ELISA KIT|Human
EF000224 96 Tests
EUR 689
Human TGFBR2 ELISA Kit
ELA-E9935h 96 Tests
EUR 824
Mouse TGFBR2 shRNA Plasmid
20-abx973091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TGFBR2 shRNA Plasmid
20-abx986725
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TGFBR2 Antibody, HRP conjugated
1-CSB-PA023452LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TGFBR2 Antibody, FITC conjugated
1-CSB-PA023452LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TGFBR2 Antibody, Biotin conjugated
1-CSB-PA023452LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFBR2. Recognizes TGFBR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TGFBR2 (pS225 / 250) Antibody
abx333097-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
Human TGFBR2 shRNA Plasmid
20-abx954821
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Phospho-TGFBR2 (Tyr284) Antibody
AF8191 200ul
EUR 376
Description: TGFBR2 (Phospho-Tyr284) Antibody detects endogenous levels of TGFBR2 only when phosphorylated at Tyr284.
TGFBR2 (Phospho- Tyr284) Antibody
ABF8191 100 ug
EUR 438
pLVX-IRES-Puro-TGFBR2
PVT14011 2 ug
EUR 599
Recombinant Human TGFBR2 Protein
RP00239 10 μg
EUR 174