Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-b-96T 96T
EUR 641
  • Should the Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-Hu-48T 48T
EUR 425
  • Should the Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-Hu-96T 96T
EUR 548
  • Should the Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-Mu-48T 48T
EUR 435
  • Should the Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma or other biological fluids.
Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-Mu-96T 96T
EUR 561
  • Should the Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma or other biological fluids.
Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-p-48T 48T
EUR 493
  • Should the Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-p-96T 96T
EUR 641
  • Should the Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-Rb-48T 48T
EUR 454
  • Should the Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
DLR-TGFbI-Rb-96T 96T
EUR 587
  • Should the Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-b-48Tests 48 Tests
EUR 494
Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-b-96Tests 96 Tests
EUR 684
Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-Hu-48Tests 48 Tests
EUR 418
Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-Hu-96Tests 96 Tests
EUR 575
Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-Mu-48Tests 48 Tests
EUR 429
Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-Mu-96Tests 96 Tests
EUR 591
Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-p-48Tests 48 Tests
EUR 494
Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-p-96Tests 96 Tests
EUR 684
Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-Rb-48Tests 48 Tests
EUR 450
Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RD-TGFbI-Rb-96Tests 96 Tests
EUR 622
Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-b-48Tests 48 Tests
EUR 516
Bovine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-b-96Tests 96 Tests
EUR 716
Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-Hu-48Tests 48 Tests
EUR 436
Human Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-Hu-96Tests 96 Tests
EUR 601
Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-Mu-48Tests 48 Tests
EUR 447
Mouse Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-Mu-96Tests 96 Tests
EUR 618
Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-p-48Tests 48 Tests
EUR 516
Porcine Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-p-96Tests 96 Tests
EUR 716
Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-Rb-48Tests 48 Tests
EUR 470
Rabbit Transforming Growth Factor Beta Induced Protein (TGFbI) ELISA Kit
RDR-TGFbI-Rb-96Tests 96 Tests
EUR 651
EF008832 96 Tests
EUR 689
PR27154 50 ug
EUR 318
TGFBI antibody
70R-1826 100 ug
EUR 377
Description: Rabbit polyclonal TGFBI antibody raised against the C terminal of TGFBI
TGFBI antibody
70R-13146 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TGFBI antibody
TGFBI antibody
70R-21462 50 ul
EUR 435
Description: Rabbit polyclonal TGFBI antibody
TGFBI Antibody
32714-100ul 100ul
EUR 252
TGFBI Antibody
49621-100ul 100ul
EUR 333
TGFBI Antibody
49621-50ul 50ul
EUR 239
TGFBI Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TGFBI. Recognizes TGFBI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TGFBI Antibody
DF7015 200ul
EUR 304
Description: TGFBI Antibody detects endogenous levels of total TGFBI.
TGFBI Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TGFBI. Recognizes TGFBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFBI Antibody
ABD7015 100 ug
EUR 438
YF-PA15013 50 ug
EUR 363
Description: Mouse polyclonal to TGFBI
YF-PA15014 100 ul
EUR 403
Description: Rabbit polyclonal to TGFBI
YF-PA15015 100 ug
EUR 403
Description: Rabbit polyclonal to TGFBI
YF-PA24842 50 ul
EUR 334
Description: Mouse polyclonal to TGFBI
TGFBI Rabbit pAb
A11222-100ul 100 ul
EUR 308
TGFBI Rabbit pAb
A11222-200ul 200 ul
EUR 459
TGFBI Rabbit pAb
A11222-20ul 20 ul
EUR 183
TGFBI Rabbit pAb
A11222-50ul 50 ul
EUR 223
TGFBI Rabbit pAb
A11916-100ul 100 ul
EUR 384
TGFBI Rabbit pAb
A11916-200ul 200 ul Ask for price
TGFBI Rabbit pAb
A11916-20ul 20 ul Ask for price
TGFBI Rabbit pAb
A11916-50ul 50 ul
EUR 265
TGFBI Blocking Peptide
33R-5094 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGFBI antibody, catalog no. 70R-1826
Human TGFBI Antibody
32916-05111 150 ug
EUR 261
TGFBI Blocking Peptide
DF7015-BP 1mg
EUR 195
TGFBI / BIGH3 Antibody
abx238641-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TGFBI / BIGH3 Antibody
abx238642-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TGFBI Conjugated Antibody
C49621 100ul
EUR 397
TGFBI Conjugated Antibody
C32714 100ul
EUR 397
TGFBI cloning plasmid
CSB-CL618988HU1-10ug 10ug
EUR 684
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2052
  • Sequence: atggcgctcttcgtgcggctgctggctctcgccctggctctggccctgggccccgccgcgaccctggcgggtcccgccaagtcgccctaccagctggtgctgcagcacagcaggctccggggccgccagcacggccccaacgtgtgtgctgtgcagaaggttattggcactaata
  • Show more
Description: A cloning plasmid for the TGFBI gene.
TGFBI cloning plasmid
CSB-CL618988HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2052
  • Sequence: atggcgctcttcgtgcggctgctggctctcgccctggctctggccctgggccccgccgcgaccctggcgggtcccgccaagtcgccctaccagctggtgctgcagcacagcaggctccggggccgccagcacggccccaacgtgtgtgctgtgcagaaggttattggcactaata
  • Show more
Description: A cloning plasmid for the TGFBI gene.
TGFBI Rabbit mAb
A2407-100ul 100 ul
EUR 410
TGFBI Rabbit mAb
A2407-200ul 200 ul
EUR 571
TGFBI Rabbit mAb
A2407-20ul 20 ul
EUR 221
TGFBI Rabbit mAb
A2407-50ul 50 ul
EUR 287
TGFBI Rabbit pAb
A2561-100ul 100 ul
EUR 308
TGFBI Rabbit pAb
A2561-200ul 200 ul
EUR 459
TGFBI Rabbit pAb
A2561-20ul 20 ul
EUR 183
TGFBI Rabbit pAb
A2561-50ul 50 ul
EUR 223
Anti-TGFBI antibody
STJ25831 100 µl
EUR 277
Description: This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy.
Anti-TGFBI antibody
STJ113459 100 µl
EUR 393
Description: This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy.
Anti-TGFBI antibody
STJ113738 100 µl
EUR 277
Description: This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy.