Ssr1/ Rat Ssr1 ELISA Kit
ELI-41774r 96 Tests
EUR 886
Human TRAPA/SSR1 (SSR1) ELISA Kit
abx392142-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SSR1 antibody
70R-20537 50 ul
EUR 435
Description: Rabbit polyclonal SSR1 antibody
SSR1 antibody
10R-5935 100 ul
EUR 691
Description: Mouse monoclonal SSR1 antibody
SSR1 antibody
10R-5936 100 ul
EUR 691
Description: Mouse monoclonal SSR1 antibody
SSR1 antibody
10R-5937 100 ul
EUR 691
Description: Mouse monoclonal SSR1 antibody
SSR1 antibody
10R-5938 100 ul
EUR 691
Description: Mouse monoclonal SSR1 antibody
SSR1 antibody
10R-5939 100 ul
EUR 691
Description: Mouse monoclonal SSR1 antibody
SSR1 antibody
10R-5940 100 ul
EUR 726
Description: Mouse monoclonal SSR1 antibody
SSR1 Antibody
45250-100ul 100ul
EUR 252
SSR1 Antibody
45250-50ul 50ul
EUR 187
SSR1 Antibody
DF8244 200ul
EUR 304
Description: SSR1 Antibody detects endogenous levels of total SSR1.
SSR1 antibody
70R-6619 50 ug
EUR 467
Description: Rabbit polyclonal SSR1 antibody raised against the middle region of SSR1
SSR1 antibody
70R-7311 50 ug
EUR 467
Description: Rabbit polyclonal SSR1 antibody
SSR1 Antibody
1-CSB-PA022717GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SSR1. Recognizes SSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SSR1 siRNA
20-abx935264
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SSR1 siRNA
20-abx935265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SSR1 Antibody
ABD8244 100 ug
EUR 438
SSR1 Blocking Peptide
33R-1878 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSR1 antibody, catalog no. 70R-7311
SSR1 Blocking Peptide
33R-3096 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSR1 antibody, catalog no. 70R-6619
SSR1 Blocking Peptide
DF8244-BP 1mg
EUR 195
SSR1 Conjugated Antibody
C45250 100ul
EUR 397
SSR1 cloning plasmid
CSB-CL022717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 861
  • Sequence: atgagactcctcccccgcttgctgctgcttctcttactcgtgttccctgccactgtcttgttccgaggcggccccagaggcttgttagcagtggcacaagatcttacagaggatgaagaaacagtagaagattccataattgaggatgaagatgatgaagccgaggtagaagaaga
  • Show more
Description: A cloning plasmid for the SSR1 gene.
SSR1 Rabbit pAb
A4129-100ul 100 ul
EUR 308
SSR1 Rabbit pAb
A4129-200ul 200 ul
EUR 459
SSR1 Rabbit pAb
A4129-20ul 20 ul
EUR 183
SSR1 Rabbit pAb
A4129-50ul 50 ul
EUR 223
Anti-SSR1 antibody
STJ111212 100 µl
EUR 277
Description: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene.
SSR1 protein (His tag)
80R-3565 20 ug
EUR 327
Description: Purified recombinant SSR1 protein (His tag)
Mouse Ssr1 ELISA KIT
ELI-18143m 96 Tests
EUR 865
Human SSR1 ELISA KIT
ELI-18917h 96 Tests
EUR 824
Bovine SSR1 ELISA KIT
ELI-53294b 96 Tests
EUR 928
Human SSR1 shRNA Plasmid
20-abx954608
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SSR1 shRNA Plasmid
20-abx979807
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti- TRAPA/SSR1 antibody
FNab08942 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: signal sequence receptor, alpha
  • Uniprot ID: P43307
  • Research Area: Metabolism
Description: Antibody raised against TRAPA/SSR1
Canine SSR1 ELISA KIT
ELI-41773d 96 Tests
EUR 928
Anti-TRAPA/SSR1 antibody
PAab08942 100 ug
EUR 412
SSR1 Recombinant Protein (Rat)
RP231182 100 ug Ask for price
SSR1 Recombinant Protein (Human)
RP030169 100 ug Ask for price
SSR1 Recombinant Protein (Mouse)
RP175634 100 ug Ask for price
Polyclonal SSR1 Antibody (N-term)
AMM07988G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSR1 (N-term). This antibody is tested and proven to work in the following applications:
TRAPA/SSR1 ELISA KIT|Human
EF003794 96 Tests
EUR 689
Ssr1 ORF Vector (Rat) (pORF)
ORF077062 1.0 ug DNA
EUR 506
SSR1 ORF Vector (Human) (pORF)
ORF010057 1.0 ug DNA
EUR 95
Ssr1 ORF Vector (Mouse) (pORF)
ORF058546 1.0 ug DNA
EUR 506
Ssr1 sgRNA CRISPR Lentivector set (Rat)
K6235501 3 x 1.0 ug
EUR 339
Ssr1 sgRNA CRISPR Lentivector set (Mouse)
K3672001 3 x 1.0 ug
EUR 339
SSR1 sgRNA CRISPR Lentivector set (Human)
K2290301 3 x 1.0 ug
EUR 339
Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
abx028061-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
abx028061-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
20-abx218772
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Translocon-Associated Protein Subunit Alpha (SSR1) Antibody
20-abx126652
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Translocon-Associated Protein Subunit Alpha (SSR1) Protein
20-abx263394
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Ssr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6235502 1.0 ug DNA
EUR 154
Ssr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6235503 1.0 ug DNA
EUR 154
Ssr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6235504 1.0 ug DNA
EUR 154
Ssr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3672002 1.0 ug DNA
EUR 154
Ssr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3672003 1.0 ug DNA
EUR 154
Ssr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3672004 1.0 ug DNA
EUR 154
SSR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2290302 1.0 ug DNA
EUR 154
SSR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2290303 1.0 ug DNA
EUR 154
SSR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2290304 1.0 ug DNA
EUR 154
SSR1 Protein Vector (Rat) (pPB-C-His)
PV308246 500 ng
EUR 603
SSR1 Protein Vector (Rat) (pPB-N-His)
PV308247 500 ng
EUR 603
SSR1 Protein Vector (Rat) (pPM-C-HA)
PV308248 500 ng
EUR 603
SSR1 Protein Vector (Rat) (pPM-C-His)
PV308249 500 ng
EUR 603
SSR1 Protein Vector (Human) (pPB-C-His)
PV040225 500 ng
EUR 329
SSR1 Protein Vector (Human) (pPB-N-His)
PV040226 500 ng
EUR 329
SSR1 Protein Vector (Human) (pPM-C-HA)
PV040227 500 ng
EUR 329
SSR1 Protein Vector (Human) (pPM-C-His)
PV040228 500 ng
EUR 329
SSR1 Protein Vector (Mouse) (pPB-C-His)
PV234182 500 ng
EUR 603
SSR1 Protein Vector (Mouse) (pPB-N-His)
PV234183 500 ng
EUR 603
SSR1 Protein Vector (Mouse) (pPM-C-HA)
PV234184 500 ng
EUR 603
SSR1 Protein Vector (Mouse) (pPM-C-His)
PV234185 500 ng
EUR 603
Recombinant Human SSR1 Protein, His, E.coli-100ug
QP13594-100ug 100ug
EUR 1261
Recombinant Human SSR1 Protein, His, E.coli-10ug
QP13594-10ug 10ug
EUR 201
Recombinant Human SSR1 Protein, His, E.coli-2ug
QP13594-2ug 2ug
EUR 155
Ssr1 3'UTR Luciferase Stable Cell Line
TU119739 1.0 ml Ask for price
Ssr1 3'UTR GFP Stable Cell Line
TU169739 1.0 ml Ask for price
Ssr1 3'UTR Luciferase Stable Cell Line
TU221220 1.0 ml Ask for price
SSR1 3'UTR GFP Stable Cell Line
TU074664 1.0 ml
EUR 4617
Ssr1 3'UTR GFP Stable Cell Line
TU271220 1.0 ml Ask for price
SSR1 3'UTR Luciferase Stable Cell Line
TU024664 1.0 ml
EUR 4617
Rabbit Translocon- associated protein subunit alpha, SSR1 ELISA
ELI-18678Ra 96 Tests
EUR 928
SSR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV648973 1.0 ug DNA
EUR 514