SPCS1 Antibody
1-CSB-PA896543LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS1. Recognizes SPCS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
SPCS1 Antibody
DF12750 200ul
EUR 304
Description: SPCS1 Antibody detects endogenous levels of SPCS1.
SPCS1 Antibody
1-CSB-PA022514GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SPCS1. Recognizes SPCS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SPCS1 siRNA
20-abx934897
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SPCS1 siRNA
20-abx934898
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pENTR223- SPCS1
PVT10042 2 ug
EUR 301
Anti-SPCS1 Antibody
A12522 100ug/vial
EUR 334
SPCS1 cloning plasmid
CSB-CL896543HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgctggagcatctgagctcgctgcccacgcagatggattacaagggccagaagctagctgaacagatgtttcagggaattattcttttttctgcaatagttggatttatctacgggtacgtggctgaacagttcgggtggactgtctatatagttatggccggatttgctttttc
  • Show more
Description: A cloning plasmid for the SPCS1 gene.
SPCS1 Blocking Peptide
DF12750-BP 1mg
EUR 195
SPCS1 Polyclonal Antibody
A61118 100 µg
EUR 570.55
Description: reagents widely cited
SPCS1 Rabbit pAb
A19472-100ul 100 ul Ask for price
SPCS1 Rabbit pAb
A19472-200ul 200 ul Ask for price
SPCS1 Rabbit pAb
A19472-20ul 20 ul Ask for price
SPCS1 Rabbit pAb
A19472-50ul 50 ul
EUR 308
anti- SPCS1 antibody
FNab08167 100µg
EUR 548.75
  • Immunogen: signal peptidase complex subunit 1 homolog(S. cerevisiae)
  • Uniprot ID: Q9Y6A9
  • Gene ID: 28972
  • Research Area: Metabolism
Description: Antibody raised against SPCS1
Anti-SPCS1 antibody
PAab08167 100 ug
EUR 386
Anti-SPCS1 antibody
STJ11100665 50 µl
EUR 287
Description: NA
SPCS1 Antibody, HRP conjugated
1-CSB-PA896543LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS1. Recognizes SPCS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SPCS1 Antibody, FITC conjugated
1-CSB-PA896543LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS1. Recognizes SPCS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SPCS1 Antibody, Biotin conjugated
1-CSB-PA896543LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS1. Recognizes SPCS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Canine SPCS1 ELISA KIT
ELI-18730d 96 Tests
EUR 928
SPCS1 ELISA KIT|Human
EF003180 96 Tests
EUR 689
Mouse SPCS1 shRNA Plasmid
20-abx976820
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SPCS1 shRNA Plasmid
20-abx959138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SPCS1 Recombinant Protein (Rat)
RP230711 100 ug Ask for price
SPCS1 Recombinant Protein (Human)
RP029845 100 ug Ask for price
SPCS1 Recombinant Protein (Mouse)
RP174875 100 ug Ask for price
SPCS1 Polyclonal Antibody, Biotin Conjugated
A61119 100 µg
EUR 570.55
Description: Ask the seller for details
SPCS1 Polyclonal Antibody, FITC Conjugated
A61120 100 µg
EUR 570.55
Description: The best epigenetics products
SPCS1 Polyclonal Antibody, HRP Conjugated
A61121 100 µg
EUR 570.55
Description: kits suitable for this type of research
Spcs1 ORF Vector (Rat) (pORF)
ORF076905 1.0 ug DNA
EUR 506
SPCS1 ORF Vector (Human) (pORF)
ORF009949 1.0 ug DNA
EUR 95
Spcs1 ORF Vector (Mouse) (pORF)
ORF058293 1.0 ug DNA
EUR 506
Spcs1 sgRNA CRISPR Lentivector set (Rat)
K7257901 3 x 1.0 ug
EUR 339
Spcs1 sgRNA CRISPR Lentivector set (Mouse)
K3536001 3 x 1.0 ug
EUR 339
SPCS1 sgRNA CRISPR Lentivector set (Human)
K2269501 3 x 1.0 ug
EUR 339
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody
20-abx003514
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody
20-abx115542
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody
abx238167-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody
20-abx312374
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Spcs1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7257902 1.0 ug DNA
EUR 154
Spcs1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7257903 1.0 ug DNA
EUR 154
Spcs1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7257904 1.0 ug DNA
EUR 154
Spcs1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3536002 1.0 ug DNA
EUR 154
Spcs1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3536003 1.0 ug DNA
EUR 154
Spcs1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3536004 1.0 ug DNA
EUR 154
SPCS1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2269502 1.0 ug DNA
EUR 154
SPCS1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2269503 1.0 ug DNA
EUR 154
SPCS1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2269504 1.0 ug DNA
EUR 154
SPCS1 Protein Vector (Rat) (pPB-C-His)
PV307618 500 ng
EUR 603
SPCS1 Protein Vector (Rat) (pPB-N-His)
PV307619 500 ng
EUR 603
SPCS1 Protein Vector (Rat) (pPM-C-HA)
PV307620 500 ng
EUR 603
SPCS1 Protein Vector (Rat) (pPM-C-His)
PV307621 500 ng
EUR 603
SPCS1 Protein Vector (Human) (pPB-C-His)
PV039793 500 ng
EUR 329
SPCS1 Protein Vector (Human) (pPB-N-His)
PV039794 500 ng
EUR 329
SPCS1 Protein Vector (Human) (pPM-C-HA)
PV039795 500 ng
EUR 329
SPCS1 Protein Vector (Human) (pPM-C-His)
PV039796 500 ng
EUR 329
SPCS1 Protein Vector (Mouse) (pPB-C-His)
PV233170 500 ng
EUR 603
SPCS1 Protein Vector (Mouse) (pPB-N-His)
PV233171 500 ng
EUR 603
SPCS1 Protein Vector (Mouse) (pPM-C-HA)
PV233172 500 ng
EUR 603
SPCS1 Protein Vector (Mouse) (pPM-C-His)
PV233173 500 ng
EUR 603
Spcs1 3'UTR Luciferase Stable Cell Line
TU119553 1.0 ml Ask for price
Spcs1 3'UTR GFP Stable Cell Line
TU169553 1.0 ml Ask for price
Spcs1 3'UTR Luciferase Stable Cell Line
TU221053 1.0 ml Ask for price
SPCS1 3'UTR GFP Stable Cell Line
TU074429 1.0 ml
EUR 1394
Spcs1 3'UTR GFP Stable Cell Line
TU271053 1.0 ml Ask for price
SPCS1 3'UTR Luciferase Stable Cell Line
TU024429 1.0 ml
EUR 1394
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody (HRP)
20-abx312375
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody (FITC)
20-abx312376
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 1 (SPCS1) Antibody (Biotin)
20-abx312377
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SPCS1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV630847 1.0 ug DNA
EUR 514
SPCS1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV630851 1.0 ug DNA
EUR 514
SPCS1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV630852 1.0 ug DNA
EUR 514
SPCS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792925 1.0 ug DNA
EUR 316
SPCS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792926 1.0 ug DNA
EUR 316
Bovine Signal peptidase complex subunit 1, SPCS1 ELISA KIT
ELI-20040b 96 Tests
EUR 928
Mouse Signal peptidase complex subunit 1, Spcs1 ELISA KIT
ELI-29116m 96 Tests
EUR 865
Porcine Signal peptidase complex subunit 1, SPCS1 ELISA KIT
ELI-29117p 96 Tests
EUR 928
Human Signal peptidase complex subunit 1, SPCS1 ELISA KIT
ELI-29628h 96 Tests
EUR 824
Human Signal Peptidase Complex Subunit 1 (SPCS1) ELISA Kit
abx383412-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Spcs1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7257905 3 x 1.0 ug
EUR 376
Spcs1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3536005 3 x 1.0 ug
EUR 376
SPCS1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2269505 3 x 1.0 ug
EUR 376
ELISA kit for Canine Signal peptidase complex subunit 1 (SPCS1)
KTE20028-48T 48T
EUR 354
  • SPCS1 (Signal Peptidase Complex Subunit 1) is a Protein Coding gene. Among its related pathways are Incretin synthesis, secretion, and inactivation and Peptide hormone metabolism. GO annotations related to SPCS1 include peptidase activity and ribosom
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Signal peptidase complex subunit 1 (SPCS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Canine Signal peptidase complex subunit 1 (SPCS1)
KTE20028-5platesof96wells 5 plates of 96 wells
EUR 2252
  • SPCS1 (Signal Peptidase Complex Subunit 1) is a Protein Coding gene. Among its related pathways are Incretin synthesis, secretion, and inactivation and Peptide hormone metabolism. GO annotations related to SPCS1 include peptidase activity and ribosom
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Signal peptidase complex subunit 1 (SPCS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.