SLC25A38 Antibody
1-CSB-PA846607LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A38. Recognizes SLC25A38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
SLC25A38 Antibody
1-CSB-PA091535
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A38. Recognizes SLC25A38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
SLC25A38 Antibody
1-CSB-PA970952
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A38. Recognizes SLC25A38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
SLC25A38 antibody
70R-6469 50 ug
EUR 467
Description: Rabbit polyclonal SLC25A38 antibody raised against the middle region of SLC25A38
Slc25a38/ Rat Slc25a38 ELISA Kit
ELI-29651r 96 Tests
EUR 886
SLC25A38 Conjugated Antibody
C37936 100ul
EUR 397
SLC25A38 Antibody (HRP)
20-abx309813
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A38 Antibody (FITC)
20-abx309814
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A38 Antibody (Biotin)
20-abx309815
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A38 Polyclonal Antibody
A60958 100 µg
EUR 570.55
Description: reagents widely cited
Anti-SLC25A38 antibody
STJ115184 100 µl
EUR 277
Description: This gene is a member of the mitochondrial carrier family. The encoded protein is required during erythropoiesis and is important for the biosynthesis of heme. Mutations in this gene are the cause of autosomal congenital sideroblastic anemia.
SLC25A38 siRNA
20-abx905013
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A38 siRNA
20-abx933736
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A38 siRNA
20-abx933737
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A38 Antibody, HRP conjugated
1-CSB-PA846607LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A38. Recognizes SLC25A38 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC25A38 Antibody, FITC conjugated
1-CSB-PA846607LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A38. Recognizes SLC25A38 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC25A38 Antibody, Biotin conjugated
1-CSB-PA846607LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A38. Recognizes SLC25A38 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SLC25A38 Rabbit pAb
A13218-100ul 100 ul
EUR 308
SLC25A38 Rabbit pAb
A13218-200ul 200 ul
EUR 459
SLC25A38 Rabbit pAb
A13218-20ul 20 ul
EUR 183
SLC25A38 Rabbit pAb
A13218-50ul 50 ul
EUR 223
SLC25A38 Blocking Peptide
33R-9563 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A38 antibody, catalog no. 70R-6469
SLC25A38 cloning plasmid
CSB-CL846607HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 915
  • Sequence: atgattcagaactcacgtccgtcgctgctgcaaccccaagatgtcggagacacggtggaaacgcttatgttacatccggtgatcaaggctttcctgtgtggctccatcagtgggacctgctctaccctccttttccaacctctggatctccttaaaacacgcctacaaaccctcca
  • Show more
Description: A cloning plasmid for the SLC25A38 gene.
pCMV-SPORT6-SLC25A38
PVT13773 2 ug
EUR 391
Polyclonal SLC25A38 Antibody (Internal region)
APR10033G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLC25A38 (Internal region). This antibody is tested and proven to work in the following applications:
Polyclonal SLC25A38 antibody - middle region
APR10034G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A38 - middle region. This antibody is tested and proven to work in the following applications:
SLC25A38 Polyclonal Antibody, Biotin Conjugated
A60959 100 µg
EUR 570.55
Description: Ask the seller for details
SLC25A38 Polyclonal Antibody, FITC Conjugated
A60960 100 µg
EUR 570.55
Description: The best epigenetics products
SLC25A38 Polyclonal Antibody, HRP Conjugated
A60961 100 µg
EUR 570.55
Description: kits suitable for this type of research
Rat SLC25A38 shRNA Plasmid
20-abx989104
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SLC25A38 shRNA Plasmid
20-abx960374
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SLC25A38 shRNA Plasmid
20-abx980559
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC25A38 Recombinant Protein (Human)
RP028879 100 ug Ask for price
SLC25A38 Recombinant Protein (Rat)
RP229247 100 ug Ask for price
SLC25A38 Recombinant Protein (Mouse)
RP172691 100 ug Ask for price
Slc25a38 ORF Vector (Rat) (pORF)
ORF076417 1.0 ug DNA
EUR 506
SLC25A38 ORF Vector (Human) (pORF)
ORF009627 1.0 ug DNA
EUR 95
Slc25a38 ORF Vector (Mouse) (pORF)
ORF057565 1.0 ug DNA
EUR 506
Solute Carrier Family 25 Member 38 (SLC25A38) Antibody
20-abx210697
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Solute Carrier Family 25 Member 38 (SLC25A38) Antibody
20-abx339389
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Solute Carrier Family 25 Member 38 (SLC25A38) Antibody
20-abx309812
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Solute Carrier Family 25 Member 38 (SLC25A38) Antibody
abx431619-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Slc25a38 sgRNA CRISPR Lentivector set (Mouse)
K4900901 3 x 1.0 ug
EUR 339
Slc25a38 sgRNA CRISPR Lentivector set (Rat)
K7142501 3 x 1.0 ug
EUR 339
SLC25A38 sgRNA CRISPR Lentivector set (Human)
K2180101 3 x 1.0 ug
EUR 339
Slc25a38 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4900902 1.0 ug DNA
EUR 154
Slc25a38 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4900903 1.0 ug DNA
EUR 154
Slc25a38 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4900904 1.0 ug DNA
EUR 154
Slc25a38 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7142502 1.0 ug DNA
EUR 154
Slc25a38 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7142503 1.0 ug DNA
EUR 154
Slc25a38 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7142504 1.0 ug DNA
EUR 154
SLC25A38 sgRNA CRISPR Lentivector (Human) (Target 1)
K2180102 1.0 ug DNA
EUR 154
SLC25A38 sgRNA CRISPR Lentivector (Human) (Target 2)
K2180103 1.0 ug DNA
EUR 154
SLC25A38 sgRNA CRISPR Lentivector (Human) (Target 3)
K2180104 1.0 ug DNA
EUR 154
SLC25A38 Protein Vector (Rat) (pPB-C-His)
PV305666 500 ng
EUR 603
SLC25A38 Protein Vector (Rat) (pPB-N-His)
PV305667 500 ng
EUR 603
SLC25A38 Protein Vector (Rat) (pPM-C-HA)
PV305668 500 ng
EUR 603
SLC25A38 Protein Vector (Rat) (pPM-C-His)
PV305669 500 ng
EUR 603
SLC25A38 Protein Vector (Human) (pPB-C-His)
PV038505 500 ng
EUR 329
SLC25A38 Protein Vector (Human) (pPB-N-His)
PV038506 500 ng
EUR 329
SLC25A38 Protein Vector (Human) (pPM-C-HA)
PV038507 500 ng
EUR 329
SLC25A38 Protein Vector (Human) (pPM-C-His)
PV038508 500 ng
EUR 329
SLC25A38 Protein Vector (Mouse) (pPB-C-His)
PV230258 500 ng
EUR 603
SLC25A38 Protein Vector (Mouse) (pPB-N-His)
PV230259 500 ng
EUR 603
SLC25A38 Protein Vector (Mouse) (pPM-C-HA)
PV230260 500 ng
EUR 603
SLC25A38 Protein Vector (Mouse) (pPM-C-His)
PV230261 500 ng
EUR 603
Slc25a38 3'UTR Luciferase Stable Cell Line
TU119017 1.0 ml Ask for price
Slc25a38 3'UTR GFP Stable Cell Line
TU169017 1.0 ml Ask for price
Slc25a38 3'UTR Luciferase Stable Cell Line
TU220544 1.0 ml Ask for price
Slc25a38 3'UTR GFP Stable Cell Line
TU270544 1.0 ml Ask for price
SLC25A38 3'UTR GFP Stable Cell Line
TU073516 1.0 ml
EUR 1394
SLC25A38 3'UTR Luciferase Stable Cell Line
TU023516 1.0 ml
EUR 1394
SLC25A38 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV679423 1.0 ug DNA
EUR 514
SLC25A38 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV679427 1.0 ug DNA
EUR 514
SLC25A38 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV679428 1.0 ug DNA
EUR 514
Mouse Solute carrier family 25 member 38, Slc25a38 ELISA KIT
ELI-18440m 96 Tests
EUR 865
Human Solute carrier family 25 member 38, SLC25A38 ELISA KIT
ELI-20107h 96 Tests
EUR 824
Bovine Solute carrier family 25 member 38, SLC25A38 ELISA KIT
ELI-52781b 96 Tests
EUR 928
Slc25a38 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4900905 3 x 1.0 ug
EUR 376
Slc25a38 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7142505 3 x 1.0 ug
EUR 376
SLC25A38 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2180105 3 x 1.0 ug
EUR 376
Slc25a38 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4900906 1.0 ug DNA
EUR 167
Slc25a38 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4900907 1.0 ug DNA
EUR 167
Slc25a38 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4900908 1.0 ug DNA
EUR 167
SLC25A38 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV679424 1.0 ug DNA
EUR 514