SEC23IP Antibody
1-CSB-PA896767LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
SEC23IP antibody
70R-9168 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SEC23IP antibody
SEC23IP antibody
70R-9169 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SEC23IP antibody
SEC23IP Antibody
1-CSB-PA020949GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SEC23IP siRNA
20-abx932774
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SEC23IP
YF-PA17500 50 ug
EUR 363
Description: Mouse polyclonal to SEC23IP
anti-SEC23IP
YF-PA17501 50 ul
EUR 363
Description: Mouse polyclonal to SEC23IP
SEC23IP Polyclonal Antibody
28948-100ul 100ul
EUR 252
SEC23IP Polyclonal Antibody
28948-50ul 50ul
EUR 187
SEC23IP Rabbit pAb
A15398-100ul 100 ul
EUR 308
SEC23IP Rabbit pAb
A15398-200ul 200 ul
EUR 459
SEC23IP Rabbit pAb
A15398-20ul 20 ul
EUR 183
SEC23IP Rabbit pAb
A15398-50ul 50 ul
EUR 223
SEC23IP Blocking Peptide
33R-8530 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC23IP antibody, catalog no. 70R-9169
SEC23IP Blocking Peptide
33R-9723 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC23IP antibody, catalog no. 70R-9168
SEC23IP cloning plasmid
CSB-CL896767HU-10ug 10ug
EUR 1111
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3003
  • Sequence: atggccgagagaaaacctaacggtggcagcggcggcgcctccacttcctcatcgggcactaacttacttttctcctcctcggccacggagttcagcttcaatgtgcccttcatcccagtcacccaggcctccgcttctccggcctccctgctcttaccgggagaggattccacag
  • Show more
Description: A cloning plasmid for the SEC23IP gene.
SEC23IP Rabbit pAb
A3381-100ul 100 ul
EUR 308
SEC23IP Rabbit pAb
A3381-200ul 200 ul
EUR 459
SEC23IP Rabbit pAb
A3381-20ul 20 ul Ask for price
SEC23IP Rabbit pAb
A3381-50ul 50 ul Ask for price
anti- SEC23IP antibody
FNab07680 100µg
EUR 548.75
  • Immunogen: SEC23 interacting protein
  • Uniprot ID: Q9Y6Y8
  • Gene ID: 11196
  • Research Area: Metabolism
Description: Antibody raised against SEC23IP
Anti-SEC23IP antibody
PAab07680 100 ug
EUR 386
Anti-SEC23IP antibody
STJ25464 100 µl
EUR 277
Description: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene.
Anti-SEC23IP antibody
STJ117593 100 µl
EUR 277
Description: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene.
SEC23IP Antibody, HRP conjugated
1-CSB-PA896767LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEC23IP Antibody, FITC conjugated
1-CSB-PA896767LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEC23IP Antibody, Biotin conjugated
1-CSB-PA896767LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SEC23IP ELISA KIT|Human
EF002788 96 Tests
EUR 689
SEC23IP Polyclonal Conjugated Antibody
C28948 100ul
EUR 397
Human SEC23IP shRNA Plasmid
20-abx957673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEC23-Interacting Protein (SEC23IP) Antibody
abx028105-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SEC23-Interacting Protein (SEC23IP) Antibody
abx028105-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sec23 Interacting Protein (SEC23IP) Antibody
20-abx115399
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
SEC23-Interacting Protein (SEC23IP) Antibody
abx237680-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Polyclonal SEC23IP Antibody (C-term)
APR14400G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC23IP (C-term). This antibody is tested and proven to work in the following applications:
SEC23-Interacting Protein (SEC23IP) Antibody
20-abx302598
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC23-Interacting Protein (SEC23IP) Antibody
20-abx002417
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Sec23ip ORF Vector (Rat) (pORF)
ORF075965 1.0 ug DNA
EUR 506
SEC23IP ORF Vector (Human) (pORF)
ORF009301 1.0 ug DNA
EUR 95
Sec23ip ORF Vector (Mouse) (pORF)
ORF056856 1.0 ug DNA
EUR 506
SEC23-Interacting Protein (SEC23IP) Antibody (HRP)
20-abx316691
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC23-Interacting Protein (SEC23IP) Antibody (FITC)
20-abx316692
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC23-Interacting Protein (SEC23IP) Antibody (Biotin)
20-abx316693
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec23ip sgRNA CRISPR Lentivector set (Rat)
K7334101 3 x 1.0 ug
EUR 339
Sec23ip sgRNA CRISPR Lentivector set (Mouse)
K4330401 3 x 1.0 ug
EUR 339
SEC23IP sgRNA CRISPR Lentivector set (Human)
K2113401 3 x 1.0 ug
EUR 339
Human SEC23- interacting protein, SEC23IP ELISA KIT
ELI-20106h 96 Tests
EUR 824
Mouse SEC23- interacting protein, Sec23ip ELISA KIT
ELI-21741m 96 Tests
EUR 865
Human SEC23-interacting protein (SEC23IP) ELISA Kit
abx383086-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse SEC23-interacting protein (SEC23IP) ELISA Kit
abx390504-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Sec23ip sgRNA CRISPR Lentivector (Rat) (Target 1)
K7334102 1.0 ug DNA
EUR 154
Sec23ip sgRNA CRISPR Lentivector (Rat) (Target 2)
K7334103 1.0 ug DNA
EUR 154
Sec23ip sgRNA CRISPR Lentivector (Rat) (Target 3)
K7334104 1.0 ug DNA
EUR 154
Sec23ip sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4330402 1.0 ug DNA
EUR 154
Sec23ip sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4330403 1.0 ug DNA
EUR 154
Sec23ip sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4330404 1.0 ug DNA
EUR 154
SEC23IP sgRNA CRISPR Lentivector (Human) (Target 1)
K2113402 1.0 ug DNA
EUR 154
SEC23IP sgRNA CRISPR Lentivector (Human) (Target 2)
K2113403 1.0 ug DNA
EUR 154
SEC23IP sgRNA CRISPR Lentivector (Human) (Target 3)
K2113404 1.0 ug DNA
EUR 154
SEC23IP Protein Vector (Rat) (pPB-C-His)
PV303858 500 ng
EUR 1166
SEC23IP Protein Vector (Rat) (pPB-N-His)
PV303859 500 ng
EUR 1166
SEC23IP Protein Vector (Rat) (pPM-C-HA)
PV303860 500 ng
EUR 1166
SEC23IP Protein Vector (Rat) (pPM-C-His)
PV303861 500 ng
EUR 1166
SEC23IP Protein Vector (Mouse) (pPB-C-His)
PV227422 500 ng
EUR 1065
SEC23IP Protein Vector (Mouse) (pPB-N-His)
PV227423 500 ng
EUR 1065
SEC23IP Protein Vector (Mouse) (pPM-C-HA)
PV227424 500 ng
EUR 1065
SEC23IP Protein Vector (Mouse) (pPM-C-His)
PV227425 500 ng
EUR 1065
SEC23IP Protein Vector (Human) (pPB-C-His)
PV037201 500 ng
EUR 329
SEC23IP Protein Vector (Human) (pPB-N-His)
PV037202 500 ng
EUR 329
SEC23IP Protein Vector (Human) (pPM-C-HA)
PV037203 500 ng
EUR 329
SEC23IP Protein Vector (Human) (pPM-C-His)
PV037204 500 ng
EUR 329
Sec23ip 3'UTR Luciferase Stable Cell Line
TU118499 1.0 ml Ask for price
Sec23ip 3'UTR GFP Stable Cell Line
TU168499 1.0 ml Ask for price
Sec23ip 3'UTR Luciferase Stable Cell Line
TU220061 1.0 ml Ask for price
Sec23ip 3'UTR GFP Stable Cell Line
TU270061 1.0 ml Ask for price
SEC23IP 3'UTR GFP Stable Cell Line
TU072837 1.0 ml
EUR 1521
SEC23IP 3'UTR Luciferase Stable Cell Line
TU022837 1.0 ml
EUR 1521
SEC23IP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV633247 1.0 ug DNA
EUR 1355
SEC23IP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV633251 1.0 ug DNA
EUR 1355
SEC23IP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV633252 1.0 ug DNA
EUR 1355
Sec23ip ELISA Kit| Mouse SEC23-interacting protein ELISA Kit
EF016146 96 Tests
EUR 689
Sec23ip sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7334105 3 x 1.0 ug
EUR 376
Sec23ip sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4330405 3 x 1.0 ug
EUR 376
SEC23IP sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2113405 3 x 1.0 ug
EUR 376
SEC23IP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV633248 1.0 ug DNA
EUR 1355