Beopenlab

SEC23IP Antibody
1-CSB-PA896767LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

SEC23IP antibody
70R-9168	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SEC23IP antibody

SEC23IP antibody
70R-9169	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SEC23IP antibody

SEC23IP Antibody
1-CSB-PA020949GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SEC23IP siRNA
20-abx932774	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SEC23IP
YF-PA17500	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SEC23IP

anti-SEC23IP
YF-PA17501	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to SEC23IP

SEC23IP Polyclonal Antibody
28948-100ul	SAB	100ul	EUR 252

SEC23IP Polyclonal Antibody
28948-50ul	SAB	50ul	EUR 187

SEC23IP Rabbit pAb
A15398-100ul	Abclonal	100 ul	EUR 308

SEC23IP Rabbit pAb
A15398-200ul	Abclonal	200 ul	EUR 459

SEC23IP Rabbit pAb
A15398-20ul	Abclonal	20 ul	EUR 183

SEC23IP Rabbit pAb
A15398-50ul	Abclonal	50 ul	EUR 223

SEC23IP Blocking Peptide
33R-8530	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC23IP antibody, catalog no. 70R-9169

SEC23IP Blocking Peptide
33R-9723	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC23IP antibody, catalog no. 70R-9168

SEC23IP cloning plasmid
CSB-CL896767HU-10ug	Cusabio	10ug	EUR 1111
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3003 Sequence: atggccgagagaaaacctaacggtggcagcggcggcgcctccacttcctcatcgggcactaacttacttttctcctcctcggccacggagttcagcttcaatgtgcccttcatcccagtcacccaggcctccgcttctccggcctccctgctcttaccgggagaggattccacag Show more
Description: A cloning plasmid for the SEC23IP gene.

SEC23IP Rabbit pAb
A3381-100ul	Abclonal	100 ul	EUR 308

SEC23IP Rabbit pAb
A3381-200ul	Abclonal	200 ul	EUR 459

SEC23IP Rabbit pAb
A3381-20ul	Abclonal	20 ul	Ask for price

SEC23IP Rabbit pAb
A3381-50ul	Abclonal	50 ul	Ask for price

anti- SEC23IP antibody
FNab07680	FN Test	100µg	EUR 548.75
Immunogen: SEC23 interacting protein Uniprot ID: Q9Y6Y8 Gene ID: 11196 Research Area: Metabolism
Description: Antibody raised against SEC23IP

Anti-SEC23IP antibody
PAab07680	Lifescience Market	100 ug	EUR 386

Anti-SEC23IP antibody
STJ25464	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene.

Anti-SEC23IP antibody
STJ117593	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene.

SEC23IP Antibody, HRP conjugated
1-CSB-PA896767LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEC23IP Antibody, FITC conjugated
1-CSB-PA896767LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEC23IP Antibody, Biotin conjugated
1-CSB-PA896767LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC23IP. Recognizes SEC23IP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SEC23IP ELISA KIT|Human
EF002788	Lifescience Market	96 Tests	EUR 689

SEC23IP Polyclonal Conjugated Antibody
C28948	SAB	100ul	EUR 397

Human SEC23IP shRNA Plasmid
20-abx957673	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC23-Interacting Protein (SEC23IP) Antibody
abx028105-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SEC23-Interacting Protein (SEC23IP) Antibody
abx028105-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sec23 Interacting Protein (SEC23IP) Antibody
20-abx115399	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

SEC23-Interacting Protein (SEC23IP) Antibody
abx237680-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Polyclonal SEC23IP Antibody (C-term)
APR14400G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC23IP (C-term). This antibody is tested and proven to work in the following applications:

SEC23-Interacting Protein (SEC23IP) Antibody
20-abx302598	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC23-Interacting Protein (SEC23IP) Antibody
20-abx002417	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Sec23ip ORF Vector (Rat) (pORF)
ORF075965	ABM	1.0 ug DNA	EUR 506

SEC23IP ORF Vector (Human) (pORF)
ORF009301	ABM	1.0 ug DNA	EUR 95

Sec23ip ORF Vector (Mouse) (pORF)
ORF056856	ABM	1.0 ug DNA	EUR 506

SEC23-Interacting Protein (SEC23IP) Antibody (HRP)
20-abx316691	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC23-Interacting Protein (SEC23IP) Antibody (FITC)
20-abx316692	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC23-Interacting Protein (SEC23IP) Antibody (Biotin)
20-abx316693	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sec23ip sgRNA CRISPR Lentivector set (Rat)
K7334101	ABM	3 x 1.0 ug	EUR 339

Sec23ip sgRNA CRISPR Lentivector set (Mouse)
K4330401	ABM	3 x 1.0 ug	EUR 339

SEC23IP sgRNA CRISPR Lentivector set (Human)
K2113401	ABM	3 x 1.0 ug	EUR 339

Human SEC23- interacting protein, SEC23IP ELISA KIT
ELI-20106h	Lifescience Market	96 Tests	EUR 824

Mouse SEC23- interacting protein, Sec23ip ELISA KIT
ELI-21741m	Lifescience Market	96 Tests	EUR 865

Human SEC23-interacting protein (SEC23IP) ELISA Kit
abx383086-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse SEC23-interacting protein (SEC23IP) ELISA Kit
abx390504-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Sec23ip sgRNA CRISPR Lentivector (Rat) (Target 1)
K7334102	ABM	1.0 ug DNA	EUR 154

Sec23ip sgRNA CRISPR Lentivector (Rat) (Target 2)
K7334103	ABM	1.0 ug DNA	EUR 154

Sec23ip sgRNA CRISPR Lentivector (Rat) (Target 3)
K7334104	ABM	1.0 ug DNA	EUR 154

Sec23ip sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4330402	ABM	1.0 ug DNA	EUR 154

Sec23ip sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4330403	ABM	1.0 ug DNA	EUR 154

Sec23ip sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4330404	ABM	1.0 ug DNA	EUR 154

SEC23IP sgRNA CRISPR Lentivector (Human) (Target 1)
K2113402	ABM	1.0 ug DNA	EUR 154

SEC23IP sgRNA CRISPR Lentivector (Human) (Target 2)
K2113403	ABM	1.0 ug DNA	EUR 154

SEC23IP sgRNA CRISPR Lentivector (Human) (Target 3)
K2113404	ABM	1.0 ug DNA	EUR 154

SEC23IP Protein Vector (Rat) (pPB-C-His)
PV303858	ABM	500 ng	EUR 1166

SEC23IP Protein Vector (Rat) (pPB-N-His)
PV303859	ABM	500 ng	EUR 1166

SEC23IP Protein Vector (Rat) (pPM-C-HA)
PV303860	ABM	500 ng	EUR 1166

SEC23IP Protein Vector (Rat) (pPM-C-His)
PV303861	ABM	500 ng	EUR 1166

SEC23IP Protein Vector (Mouse) (pPB-C-His)
PV227422	ABM	500 ng	EUR 1065

SEC23IP Protein Vector (Mouse) (pPB-N-His)
PV227423	ABM	500 ng	EUR 1065

SEC23IP Protein Vector (Mouse) (pPM-C-HA)
PV227424	ABM	500 ng	EUR 1065

SEC23IP Protein Vector (Mouse) (pPM-C-His)
PV227425	ABM	500 ng	EUR 1065

SEC23IP Protein Vector (Human) (pPB-C-His)
PV037201	ABM	500 ng	EUR 329

SEC23IP Protein Vector (Human) (pPB-N-His)
PV037202	ABM	500 ng	EUR 329

SEC23IP Protein Vector (Human) (pPM-C-HA)
PV037203	ABM	500 ng	EUR 329

SEC23IP Protein Vector (Human) (pPM-C-His)
PV037204	ABM	500 ng	EUR 329

Sec23ip 3'UTR Luciferase Stable Cell Line
TU118499	ABM	1.0 ml	Ask for price

Sec23ip 3'UTR GFP Stable Cell Line
TU168499	ABM	1.0 ml	Ask for price

Sec23ip 3'UTR Luciferase Stable Cell Line
TU220061	ABM	1.0 ml	Ask for price

Sec23ip 3'UTR GFP Stable Cell Line
TU270061	ABM	1.0 ml	Ask for price

SEC23IP 3'UTR GFP Stable Cell Line
TU072837	ABM	1.0 ml	EUR 1521

SEC23IP 3'UTR Luciferase Stable Cell Line
TU022837	ABM	1.0 ml	EUR 1521

SEC23IP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV633247	ABM	1.0 ug DNA	EUR 1355

SEC23IP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV633251	ABM	1.0 ug DNA	EUR 1355

SEC23IP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV633252	ABM	1.0 ug DNA	EUR 1355

Sec23ip ELISA Kit| Mouse SEC23-interacting protein ELISA Kit
EF016146	Lifescience Market	96 Tests	EUR 689

Sec23ip sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7334105	ABM	3 x 1.0 ug	EUR 376

Sec23ip sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4330405	ABM	3 x 1.0 ug	EUR 376

SEC23IP sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2113405	ABM	3 x 1.0 ug	EUR 376

SEC23IP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV633248	ABM	1.0 ug DNA	EUR 1355