Beopenlab

SCFD1 antibody
70R-20101	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SCFD1 antibody

SCFD1 Antibody
35011-100ul	SAB	100ul	EUR 252

SCFD1 Antibody
35011-50ul	SAB	50ul	EUR 187

SCFD1 Antibody
39510-100ul	SAB	100ul	EUR 390

SCFD1 Antibody
1-CSB-PA840987ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SCFD1 Antibody
1-CSB-PA840987ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SCFD1 Antibody
CSB-PA000673-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

SCFD1 Antibody
CSB-PA000673-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

SCFD1 Antibody
1-CSB-PA004053	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

SCFD1 Antibody
DF4450	Affbiotech	200ul	EUR 304
Description: SCFD1 Antibody detects endogenous levels of total SCFD1.

SCFD1 antibody
70R-3833	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SCFD1 antibody raised against the N terminal of SCFD1

SCFD1 Antibody
1-CSB-PA020806GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

SCFD1 siRNA
20-abx904791	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCFD1 siRNA
20-abx932565	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCFD1 siRNA
20-abx932566	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCFD1 Antibody
ABD4450	Lifescience Market	100 ug	EUR 438

Anti-SCFD1 Antibody
A09509	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal SCFD1 Antibody. Validated in WB and tested in Human.

Anti-SCFD1 Antibody
A09509-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for SCFD1 Antibody (SCFD1) detection. Tested with WB in Human, Mouse, Rat.

SCFD1 Blocking Peptide
33R-8323	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCFD1 antibody, catalog no. 70R-3833

SCFD1 Blocking Peptide
DF4450-BP	Affbiotech	1mg	EUR 195

SCFD1 Conjugated Antibody
C35011	SAB	100ul	EUR 397

SCFD1 cloning plasmid
CSB-CL840987HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1929 Sequence: atggcggcggcggcggcagcgacagcagcagcagcagccagtattcgggaaaggcagacagtggctttgaagcgtatgttgaatttcaatgtgcctcatattaaaaacagcacaggagaaccagtatggaaggtactcatttatgacagatttggccaagatataatctctcctc Show more
Description: A cloning plasmid for the SCFD1 gene.

SCFD1 Polyclonal Antibody
ABP52413-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590 Applications tips:
Description: A polyclonal antibody for detection of SCFD1 from Human, Mouse, Rat. This SCFD1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590

SCFD1 Polyclonal Antibody
ABP52413-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590 Applications tips:
Description: A polyclonal antibody for detection of SCFD1 from Human, Mouse, Rat. This SCFD1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590

SCFD1 Polyclonal Antibody
ABP52413-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590 Applications tips:
Description: A polyclonal antibody for detection of SCFD1 from Human, Mouse, Rat. This SCFD1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590

SCFD1 Rabbit pAb
A8835-100ul	Abclonal	100 ul	EUR 308

SCFD1 Rabbit pAb
A8835-200ul	Abclonal	200 ul	EUR 459

SCFD1 Rabbit pAb
A8835-20ul	Abclonal	20 ul	EUR 183

SCFD1 Rabbit pAb
A8835-50ul	Abclonal	50 ul	EUR 223

anti- SCFD1 antibody
FNab07629	FN Test	100µg	EUR 548.75
Immunogen: sec1 family domain containing 1 Uniprot ID: Q8WVM8 Gene ID: 23256 Research Area: Signal Transduction
Description: Antibody raised against SCFD1

SCFD1 Polyclonal Antibody
ES3412-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SCFD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SCFD1 Polyclonal Antibody
ES3412-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SCFD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SCFD1 antibody
PAab07629	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-SCFD1
PVT14233	Lifescience Market	2 ug	EUR 495

Anti-SCFD1 antibody
STJ111440	St John's Laboratory	100 µl	EUR 277

Anti-SCFD1 antibody
STJ95586	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to SCFD1.

SCFD1 ELISA KIT|Human
EF002738	Lifescience Market	96 Tests	EUR 689

Mouse SCFD1 shRNA Plasmid
20-abx978741	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SCFD1 shRNA Plasmid
20-abx985846	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SCFD1 shRNA Plasmid
20-abx958129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SCFD1 Recombinant Protein (Human)
RP027706	ABM	100 ug	Ask for price

SCFD1 Recombinant Protein (Rat)
RP227603	ABM	100 ug	Ask for price

SCFD1 Recombinant Protein (Mouse)
RP170189	ABM	100 ug	Ask for price

Scfd1 ORF Vector (Rat) (pORF)
ORF075869	ABM	1.0 ug DNA	EUR 506

SCFD1 ORF Vector (Human) (pORF)
ORF009236	ABM	1.0 ug DNA	EUR 95

Scfd1 ORF Vector (Mouse) (pORF)
ORF056731	ABM	1.0 ug DNA	EUR 506

Scfd1 sgRNA CRISPR Lentivector set (Rat)
K6884701	ABM	3 x 1.0 ug	EUR 339

Scfd1 sgRNA CRISPR Lentivector set (Mouse)
K3554101	ABM	3 x 1.0 ug	EUR 339

SCFD1 sgRNA CRISPR Lentivector set (Human)
K2099401	ABM	3 x 1.0 ug	EUR 339

Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx014842	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx115394	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx123984	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
abx036526-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
abx237629-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
abx330755-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx327167	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx322669	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx322101	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Scfd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6884702	ABM	1.0 ug DNA	EUR 154

Scfd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6884703	ABM	1.0 ug DNA	EUR 154

Scfd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6884704	ABM	1.0 ug DNA	EUR 154

Scfd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3554102	ABM	1.0 ug DNA	EUR 154

Scfd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3554103	ABM	1.0 ug DNA	EUR 154

Scfd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3554104	ABM	1.0 ug DNA	EUR 154

SCFD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2099402	ABM	1.0 ug DNA	EUR 154

SCFD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2099403	ABM	1.0 ug DNA	EUR 154

SCFD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2099404	ABM	1.0 ug DNA	EUR 154

SCFD1 Protein Vector (Rat) (pPB-C-His)
PV303474	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Rat) (pPB-N-His)
PV303475	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Rat) (pPM-C-HA)
PV303476	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Rat) (pPM-C-His)
PV303477	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Mouse) (pPB-C-His)
PV226922	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Mouse) (pPB-N-His)
PV226923	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Mouse) (pPM-C-HA)
PV226924	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Mouse) (pPM-C-His)
PV226925	ABM	500 ng	EUR 603

SCFD1 Protein Vector (Human) (pPB-C-His)
PV036941	ABM	500 ng	EUR 329

SCFD1 Protein Vector (Human) (pPB-N-His)
PV036942	ABM	500 ng	EUR 329

SCFD1 Protein Vector (Human) (pPM-C-HA)
PV036943	ABM	500 ng	EUR 329

SCFD1 Protein Vector (Human) (pPM-C-His)
PV036944	ABM	500 ng	EUR 329

Scfd1 3'UTR Luciferase Stable Cell Line
TU118399	ABM	1.0 ml	Ask for price

Scfd1 3'UTR GFP Stable Cell Line
TU168399	ABM	1.0 ml	Ask for price

Scfd1 3'UTR Luciferase Stable Cell Line
TU219963	ABM	1.0 ml	Ask for price

Scfd1 3'UTR GFP Stable Cell Line
TU269963	ABM	1.0 ml	Ask for price

SCFD1 3'UTR GFP Stable Cell Line
TU072695	ABM	1.0 ml	EUR 1394

SCFD1 3'UTR Luciferase Stable Cell Line
TU022695	ABM	1.0 ml	EUR 1394