SCFD1 antibody
70R-20101 50 ul
EUR 435
Description: Rabbit polyclonal SCFD1 antibody
SCFD1 Antibody
35011-100ul 100ul
EUR 252
SCFD1 Antibody
35011-50ul 50ul
EUR 187
SCFD1 Antibody
39510-100ul 100ul
EUR 390
SCFD1 Antibody
1-CSB-PA840987ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
SCFD1 Antibody
1-CSB-PA840987ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
SCFD1 Antibody
CSB-PA000673-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SCFD1 Antibody
CSB-PA000673-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SCFD1 Antibody
1-CSB-PA004053
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
SCFD1 Antibody
DF4450 200ul
EUR 304
Description: SCFD1 Antibody detects endogenous levels of total SCFD1.
SCFD1 antibody
70R-3833 50 ug
EUR 467
Description: Rabbit polyclonal SCFD1 antibody raised against the N terminal of SCFD1
SCFD1 Antibody
1-CSB-PA020806GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD1. Recognizes SCFD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
SCFD1 siRNA
20-abx904791
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCFD1 siRNA
20-abx932565
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCFD1 siRNA
20-abx932566
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCFD1 Antibody
ABD4450 100 ug
EUR 438
Anti-SCFD1 Antibody
A09509 100ul
EUR 397
Description: Rabbit Polyclonal SCFD1 Antibody. Validated in WB and tested in Human.
Anti-SCFD1 Antibody
A09509-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for SCFD1 Antibody (SCFD1) detection. Tested with WB in Human, Mouse, Rat.
SCFD1 Blocking Peptide
33R-8323 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCFD1 antibody, catalog no. 70R-3833
SCFD1 Blocking Peptide
DF4450-BP 1mg
EUR 195
SCFD1 Conjugated Antibody
C35011 100ul
EUR 397
SCFD1 cloning plasmid
CSB-CL840987HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1929
  • Sequence: atggcggcggcggcggcagcgacagcagcagcagcagccagtattcgggaaaggcagacagtggctttgaagcgtatgttgaatttcaatgtgcctcatattaaaaacagcacaggagaaccagtatggaaggtactcatttatgacagatttggccaagatataatctctcctc
  • Show more
Description: A cloning plasmid for the SCFD1 gene.
SCFD1 Polyclonal Antibody
ABP52413-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of SCFD1 from Human, Mouse, Rat. This SCFD1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590
SCFD1 Polyclonal Antibody
ABP52413-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of SCFD1 from Human, Mouse, Rat. This SCFD1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590
SCFD1 Polyclonal Antibody
ABP52413-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of SCFD1 from Human, Mouse, Rat. This SCFD1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCFD1 at AA range: 510-590
SCFD1 Rabbit pAb
A8835-100ul 100 ul
EUR 308
SCFD1 Rabbit pAb
A8835-200ul 200 ul
EUR 459
SCFD1 Rabbit pAb
A8835-20ul 20 ul
EUR 183
SCFD1 Rabbit pAb
A8835-50ul 50 ul
EUR 223
anti- SCFD1 antibody
FNab07629 100µg
EUR 548.75
  • Immunogen: sec1 family domain containing 1
  • Uniprot ID: Q8WVM8
  • Gene ID: 23256
  • Research Area: Signal Transduction
Description: Antibody raised against SCFD1
SCFD1 Polyclonal Antibody
ES3412-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SCFD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SCFD1 Polyclonal Antibody
ES3412-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SCFD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-SCFD1 antibody
PAab07629 100 ug
EUR 386
pCMV-SPORT6-SCFD1
PVT14233 2 ug
EUR 495
Anti-SCFD1 antibody
STJ111440 100 µl
EUR 277
Anti-SCFD1 antibody
STJ95586 200 µl
EUR 197
Description: Rabbit polyclonal to SCFD1.
SCFD1 ELISA KIT|Human
EF002738 96 Tests
EUR 689
Mouse SCFD1 shRNA Plasmid
20-abx978741
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SCFD1 shRNA Plasmid
20-abx985846
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SCFD1 shRNA Plasmid
20-abx958129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SCFD1 Recombinant Protein (Human)
RP027706 100 ug Ask for price
SCFD1 Recombinant Protein (Rat)
RP227603 100 ug Ask for price
SCFD1 Recombinant Protein (Mouse)
RP170189 100 ug Ask for price
Scfd1 ORF Vector (Rat) (pORF)
ORF075869 1.0 ug DNA
EUR 506
SCFD1 ORF Vector (Human) (pORF)
ORF009236 1.0 ug DNA
EUR 95
Scfd1 ORF Vector (Mouse) (pORF)
ORF056731 1.0 ug DNA
EUR 506
Scfd1 sgRNA CRISPR Lentivector set (Rat)
K6884701 3 x 1.0 ug
EUR 339
Scfd1 sgRNA CRISPR Lentivector set (Mouse)
K3554101 3 x 1.0 ug
EUR 339
SCFD1 sgRNA CRISPR Lentivector set (Human)
K2099401 3 x 1.0 ug
EUR 339
Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx014842
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx115394
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx123984
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
abx036526-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
abx237629-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
abx330755-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx327167
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx322669
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 1 (SCFD1) Antibody
20-abx322101
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Scfd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6884702 1.0 ug DNA
EUR 154
Scfd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6884703 1.0 ug DNA
EUR 154
Scfd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6884704 1.0 ug DNA
EUR 154
Scfd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3554102 1.0 ug DNA
EUR 154
Scfd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3554103 1.0 ug DNA
EUR 154
Scfd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3554104 1.0 ug DNA
EUR 154
SCFD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2099402 1.0 ug DNA
EUR 154
SCFD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2099403 1.0 ug DNA
EUR 154
SCFD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2099404 1.0 ug DNA
EUR 154
SCFD1 Protein Vector (Rat) (pPB-C-His)
PV303474 500 ng
EUR 603
SCFD1 Protein Vector (Rat) (pPB-N-His)
PV303475 500 ng
EUR 603
SCFD1 Protein Vector (Rat) (pPM-C-HA)
PV303476 500 ng
EUR 603
SCFD1 Protein Vector (Rat) (pPM-C-His)
PV303477 500 ng
EUR 603
SCFD1 Protein Vector (Mouse) (pPB-C-His)
PV226922 500 ng
EUR 603
SCFD1 Protein Vector (Mouse) (pPB-N-His)
PV226923 500 ng
EUR 603
SCFD1 Protein Vector (Mouse) (pPM-C-HA)
PV226924 500 ng
EUR 603
SCFD1 Protein Vector (Mouse) (pPM-C-His)
PV226925 500 ng
EUR 603
SCFD1 Protein Vector (Human) (pPB-C-His)
PV036941 500 ng
EUR 329
SCFD1 Protein Vector (Human) (pPB-N-His)
PV036942 500 ng
EUR 329
SCFD1 Protein Vector (Human) (pPM-C-HA)
PV036943 500 ng
EUR 329
SCFD1 Protein Vector (Human) (pPM-C-His)
PV036944 500 ng
EUR 329
Scfd1 3'UTR Luciferase Stable Cell Line
TU118399 1.0 ml Ask for price
Scfd1 3'UTR GFP Stable Cell Line
TU168399 1.0 ml Ask for price
Scfd1 3'UTR Luciferase Stable Cell Line
TU219963 1.0 ml Ask for price
Scfd1 3'UTR GFP Stable Cell Line
TU269963 1.0 ml Ask for price
SCFD1 3'UTR GFP Stable Cell Line
TU072695 1.0 ml
EUR 1394
SCFD1 3'UTR Luciferase Stable Cell Line
TU022695 1.0 ml
EUR 1394