Beopenlab

RNF40 siRNA
20-abx904619	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF40 siRNA
20-abx931792	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF40 siRNA
20-abx931793	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF40 antibody
38921-100ul	SAB	100ul	EUR 252

RNF40 Antibody
43326-100ul	SAB	100ul	EUR 252

RNF40 antibody
70R-19929	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RNF40 antibody

RNF40 antibody
70R-1057	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RNF40 antibody raised against the C terminal of RNF40

RNF40 Antibody
1-CSB-PA777302	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RNF40 Antibody
1-CSB-PA019890GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RNF40 Antibody
1-CSB-PA019890LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-RNF40
YF-PA25413	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RNF40

RNF40 Conjugated Antibody
C38921	SAB	100ul	EUR 397

RNF40 Conjugated Antibody
C43326	SAB	100ul	EUR 397

RNF40 cloning plasmid
CSB-CL019890HU-10ug	Cusabio	10ug	EUR 1112
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3006 Sequence: atgtctgggccaggcaacaaacgcgccgccggcgacgggggctcagggcccccggaaaagaagctgagtcgtgaggagaagaccaccacgactcttatcgagcccattcgtcttggaggcatctcttccacggaggagatggacctgaaggtactacagttcaagaacaagaaac Show more
Description: A cloning plasmid for the RNF40 gene.

anti- RNF40 antibody
FNab07358	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:20 - 1:100 ChIP : 1:50 - 1:200 Immunogen: ring finger protein 40 Uniprot ID: O75150 Gene ID: 9810 Research Area: Epigenetics, Metabolism
Description: Antibody raised against RNF40

RNF40 Rabbit pAb
A6443-100ul	Abclonal	100 ul	EUR 308

RNF40 Rabbit pAb
A6443-200ul	Abclonal	200 ul	EUR 459

RNF40 Rabbit pAb
A6443-20ul	Abclonal	20 ul	EUR 183

RNF40 Rabbit pAb
A6443-50ul	Abclonal	50 ul	EUR 223

RNF40 Blocking Peptide
33R-4520	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF40 antibody, catalog no. 70R-1057

Anti-RNF40 antibody
PAab07358	Lifescience Market	100 ug	EUR 386

Anti-RNF40 antibody
STJ28526	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RNF40 (1C1)
YF-MA17009	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RNF40

Rat RNF40 shRNA Plasmid
20-abx988095	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNF40 ELISA KIT|Human
EF002526	Lifescience Market	96 Tests	EUR 689

Human RNF40 shRNA Plasmid
20-abx956566	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RNF40 shRNA Plasmid
20-abx982096	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNF40 Antibody, HRP conjugated
1-CSB-PA019890LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF40 Antibody, FITC conjugated
1-CSB-PA019890LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF40 Antibody, Biotin conjugated
1-CSB-PA019890LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF40. Recognizes RNF40 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RNF40 ORF Vector (Human) (pORF)
ORF008897	ABM	1.0 ug DNA	EUR 95

Rnf40 ORF Vector (Mouse) (pORF)
ORF056223	ABM	1.0 ug DNA	EUR 506

Rnf40 ORF Vector (Rat) (pORF)
ORF075484	ABM	1.0 ug DNA	EUR 506

Ring Finger Protein 40 (RNF40) Antibody
20-abx115299	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
20-abx141864	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
abx145732-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
20-abx004936	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
abx027996-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
abx027996-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
20-abx214056	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody
abx237358-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ring Finger Protein 40 (RNF40) Antibody
20-abx301839	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RNF40 sgRNA CRISPR Lentivector set (Human)
K1836301	ABM	3 x 1.0 ug	EUR 339

Rnf40 sgRNA CRISPR Lentivector set (Mouse)
K4886301	ABM	3 x 1.0 ug	EUR 339

Rnf40 sgRNA CRISPR Lentivector set (Rat)
K7369401	ABM	3 x 1.0 ug	EUR 339

Monoclonal RNF40 Antibody (monoclonal) (M09), Clone: 1C1
AMM04029G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RNF40 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1C1. This antibody is applicable in WB and IF, E

Ring Finger Protein 40 (RNF40) Antibody (HRP)
20-abx315978	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody (FITC)
20-abx315979	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ring Finger Protein 40 (RNF40) Antibody (Biotin)
20-abx315980	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RNF40 sgRNA CRISPR Lentivector (Human) (Target 1)
K1836302	ABM	1.0 ug DNA	EUR 154

RNF40 sgRNA CRISPR Lentivector (Human) (Target 2)
K1836303	ABM	1.0 ug DNA	EUR 154

RNF40 sgRNA CRISPR Lentivector (Human) (Target 3)
K1836304	ABM	1.0 ug DNA	EUR 154

Rnf40 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4886302	ABM	1.0 ug DNA	EUR 154

Rnf40 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4886303	ABM	1.0 ug DNA	EUR 154

Rnf40 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4886304	ABM	1.0 ug DNA	EUR 154

Rnf40 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7369402	ABM	1.0 ug DNA	EUR 154

Rnf40 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7369403	ABM	1.0 ug DNA	EUR 154

Rnf40 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7369404	ABM	1.0 ug DNA	EUR 154

RNF40 Protein Vector (Human) (pPB-C-His)
PV035585	ABM	500 ng	EUR 329

RNF40 Protein Vector (Human) (pPB-N-His)
PV035586	ABM	500 ng	EUR 329

RNF40 Protein Vector (Human) (pPM-C-HA)
PV035587	ABM	500 ng	EUR 329

RNF40 Protein Vector (Human) (pPM-C-His)
PV035588	ABM	500 ng	EUR 329

RNF40 Protein Vector (Rat) (pPB-C-His)
PV301934	ABM	500 ng	EUR 1166

RNF40 Protein Vector (Rat) (pPB-N-His)
PV301935	ABM	500 ng	EUR 1166

RNF40 Protein Vector (Rat) (pPM-C-HA)
PV301936	ABM	500 ng	EUR 1166

RNF40 Protein Vector (Rat) (pPM-C-His)
PV301937	ABM	500 ng	EUR 1166

RNF40 Protein Vector (Mouse) (pPB-C-His)
PV224890	ABM	500 ng	EUR 1065

RNF40 Protein Vector (Mouse) (pPB-N-His)
PV224891	ABM	500 ng	EUR 1065

RNF40 Protein Vector (Mouse) (pPM-C-HA)
PV224892	ABM	500 ng	EUR 1065

RNF40 Protein Vector (Mouse) (pPM-C-His)
PV224893	ABM	500 ng	EUR 1065

Rnf40 3'UTR GFP Stable Cell Line
TU168011	ABM	1.0 ml	Ask for price

RNF40 3'UTR Luciferase Stable Cell Line
TU020047	ABM	1.0 ml	EUR 2333

Rnf40 3'UTR Luciferase Stable Cell Line
TU118011	ABM	1.0 ml	Ask for price

RNF40 3'UTR GFP Stable Cell Line
TU070047	ABM	1.0 ml	EUR 2333

Rnf40 3'UTR Luciferase Stable Cell Line
TU219560	ABM	1.0 ml	Ask for price

Rnf40 3'UTR GFP Stable Cell Line
TU269560	ABM	1.0 ml	Ask for price

Human Ring Finger Protein 40 (RNF40) ELISA Kit
abx382860-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

RNF40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666889	ABM	1.0 ug DNA	EUR 1355

RNF40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666893	ABM	1.0 ug DNA	EUR 1355

RNF40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666894	ABM	1.0 ug DNA	EUR 1355

Human E3 ubiquitin- protein ligase BRE1B, RNF40 ELISA KIT
ELI-33328h	Lifescience Market	96 Tests	EUR 824

Mouse E3 ubiquitin- protein ligase BRE1B, Rnf40 ELISA KIT
ELI-33329m	Lifescience Market	96 Tests	EUR 865

RNF40 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1836305	ABM	3 x 1.0 ug	EUR 376

Rnf40 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4886305	ABM	3 x 1.0 ug	EUR 376

Rnf40 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7369405	ABM	3 x 1.0 ug	EUR 376