Beopenlab

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
DLR-RHOA-Hu-96T	DL Develop	96T	EUR 673
Should the Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ras Homolog Gene Family, Member A (RHOA) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RD-RHOA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RD-RHOA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RDR-RHOA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RDR-RHOA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rhoa/ Rat Rhoa ELISA Kit
ELI-14417r	Lifescience Market	96 Tests	EUR 886

Human Transforming protein RhoA (RHOA)
1-CSB-RP008754h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 48.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transforming protein RhoA(RHOA),partial expressed in E.coli

RhoA Antibody
AF6352	Affbiotech	200ul	EUR 304
Description: RhoA Antibody detects endogenous levels of total RhoA.

RHOA siRNA
20-abx904569	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RhoA Antibody
AF7830	Affbiotech	200ul	EUR 376
Description: RhoA Antibody detects endogenous levels of RhoA.

RhoA Antibody
ABF6352	Lifescience Market	100 ug	EUR 438

RHOA siRNA
20-abx931462	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RHOA siRNA
20-abx931463	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RHOA antibody
70R-5840	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RHOA antibody raised against the middle region of RHOA

RhoA antibody
70R-36009	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RhoA antibody

RhoA Antibody
ABD6075	Lifescience Market	100 ug	EUR 438

RhoA antibody
38121-100ul	SAB	100ul	EUR 252

RhoA Antibody
49020-100ul	SAB	100ul	EUR 333

RhoA Antibody
49020-50ul	SAB	50ul	EUR 239

RHOA Antibody
31150-100ul	SAB	100ul	EUR 252

RHOA Antibody
31150-50ul	SAB	50ul	EUR 187

RhoA Antibody
21585-100ul	SAB	100ul	EUR 252

RhoA Antibody
21585-50ul	SAB	50ul	EUR 187

RHOA Antibody
25545-100ul	SAB	100ul	EUR 390

RHOA antibody
70R-19884	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RHOA antibody

RhoA antibody
70R-15157	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RhoA antibody

RhoA Antibody
DF6075	Affbiotech	200ul	EUR 304
Description: RhoA Antibody detects endogenous levels of total RhoA.

RHOA Antibody
1-CSB-PA963411	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

RHOA Antibody
1-CSB-PA003970	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RHOA Antibody
1-CSB-PA548002	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

RHOA Antibody
1-CSB-PA244505	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

RHOA Antibody
1-CSB-PA00875A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHOA Antibody
CSB-PA042169-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RHOA Antibody
CSB-PA042169-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RHOA Antibody
1-CSB-PA019682GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-RHOA
PVT18653	Lifescience Market	2 ug	EUR 231

anti-RhoA
YF-PA10313	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to RhoA

anti-RhoA
YF-PA23244	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RhoA

Cow Transforming Protein RhoA (RHOA) ELISA Kit
abx521182-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog Transforming Protein RhoA (RHOA) ELISA Kit
abx521183-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Transforming Protein RhoA (RHOA) ELISA Kit
abx521185-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Transforming Protein RhoA (RHOA) ELISA Kit
abx521186-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Transforming protein RhoA (RHOA) ELISA Kit
abx571681-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Bovine RHOA/ Transforming protein RhoA ELISA Kit
E0237Bo	Sunlong	1 Kit	EUR 717

Human RHOA/ Transforming protein RhoA ELISA Kit
E2150Hu	Sunlong	1 Kit	EUR 605

Human RHOA(Transforming protein RhoA) ELISA Kit
EH2484	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: P61586 Alias: RHOA/Rho cDNA clone 12/h12//ARH12/ARHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Mouse Transforming protein RhoA, Rhoa ELISA KIT
ELI-14416m	Lifescience Market	96 Tests	EUR 865

Human Transforming protein RhoA, RHOA ELISA KIT
ELI-45211h	Lifescience Market	96 Tests	EUR 824

Bovine Transforming protein RhoA, RHOA ELISA KIT
ELI-41098b	Lifescience Market	96 Tests	EUR 928

ELISA kit for Rat Transforming protein RhoA (RHOA)
KTE100296-48T	Abbkine	48T	EUR 332
RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily p Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming protein RhoA (RHOA)
KTE100296-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily p Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming protein RhoA (RHOA)
KTE100296-96T	Abbkine	96T	EUR 539
RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily p Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)
KTE60797-48T	Abbkine	48T	EUR 332
RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily p Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)
KTE60797-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily p Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)
KTE60797-96T	Abbkine	96T	EUR 539
RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily p Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RhoA Blocking Peptide
AF6352-BP	Affbiotech	1mg	EUR 195

RhoA Conjugated Antibody
C49020	SAB	100ul	EUR 397

RHOA Conjugated Antibody
C31150	SAB	100ul	EUR 397

RhoA Conjugated Antibody
C21585	SAB	100ul	EUR 397

RhoA Blocking Peptide
AF7830-BP	Affbiotech	1mg	EUR 195

RHOA cloning plasmid
CSB-CL019682HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 582 Sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagagttggctttgtggga Show more
Description: A cloning plasmid for the RHOA gene.

RHOA cloning plasmid
CSB-CL019682HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 582 Sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagaattggctttgtggga Show more
Description: A cloning plasmid for the RHOA gene.

anti- RHOA antibody
FNab07281	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: ras homolog gene family, member A Uniprot ID: P61586 Gene ID: 387 Research Area: Immunology, Signal Transduction
Description: Antibody raised against RHOA

RhoA Blocking Peptide
20-abx162020	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RhoA (pS188) Antibody
abx011471-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RhoA (pS188) Antibody
abx218288-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RhoA Rabbit pAb
A0272-100ul	Abclonal	100 ul	EUR 308

RhoA Rabbit pAb
A0272-200ul	Abclonal	200 ul	EUR 459

RhoA Rabbit pAb
A0272-20ul	Abclonal	20 ul	EUR 183

RhoA Rabbit pAb
A0272-50ul	Abclonal	50 ul	EUR 223

RHOA Polyclonal Antibody
A53873	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RHOA Rabbit pAb
A15641-100ul	Abclonal	100 ul	EUR 308

RHOA Rabbit pAb
A15641-200ul	Abclonal	200 ul	EUR 459

RHOA Rabbit pAb
A15641-20ul	Abclonal	20 ul	EUR 183

RHOA Rabbit pAb
A15641-50ul	Abclonal	50 ul	EUR 223

RhoA Rabbit pAb
A13947-100ul	Abclonal	100 ul	EUR 308

RhoA Rabbit pAb
A13947-200ul	Abclonal	200 ul	EUR 459

RhoA Rabbit pAb
A13947-20ul	Abclonal	20 ul	EUR 183

RhoA Rabbit pAb
A13947-50ul	Abclonal	50 ul	EUR 223

RHOA Blocking Peptide
33R-3522	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOA antibody, catalog no. 70R-5840

RhoA antibody (biotin)
60R-1308	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RhoA antibody (biotin)

RhoA antibody (FITC)
60R-1309	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RhoA antibody (FITC)

RhoA antibody (HRP)
60R-1310	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RhoA antibody (HRP)

RhoA Blocking Peptide
DF6075-BP	Affbiotech	1mg	EUR 195

Anti-RHOA antibody
PAab07281	Lifescience Market	100 ug	EUR 386