RHOA

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
DLR-RHOA-Hu-96T 96T
EUR 673
  • Should the Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ras Homolog Gene Family, Member A (RHOA) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RDR-RHOA-Hu-48Tests 48 Tests
EUR 544

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RDR-RHOA-Hu-96Tests 96 Tests
EUR 756

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RD-RHOA-Hu-48Tests 48 Tests
EUR 521

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit
RD-RHOA-Hu-96Tests 96 Tests
EUR 723

Human Transforming protein RhoA (RHOA)
1-CSB-RP008754h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transforming protein RhoA(RHOA),partial expressed in E.coli

Rhoa/ Rat Rhoa ELISA Kit
ELI-14417r 96 Tests
EUR 886

RHOA Antibody
25545-100ul 100ul
EUR 390

RhoA Antibody
21585-100ul 100ul
EUR 252

RhoA Antibody
21585-50ul 50ul
EUR 187

RHOA Antibody
31150-100ul 100ul
EUR 252

RHOA Antibody
31150-50ul 50ul
EUR 187

RHOA antibody
70R-19884 50 ul
EUR 435
Description: Rabbit polyclonal RHOA antibody

RhoA antibody
70R-15157 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody

RhoA antibody
38121-100ul 100ul
EUR 252

RhoA Antibody
49020-100ul 100ul
EUR 333

RhoA Antibody
49020-50ul 50ul
EUR 239

RHOA Antibody
1-CSB-PA003970
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RHOA Antibody
1-CSB-PA963411
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

RhoA Antibody
DF6075 200ul
EUR 304
Description: RhoA Antibody detects endogenous levels of total RhoA.

RHOA Antibody
1-CSB-PA548002
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

RHOA Antibody
CSB-PA042169-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RHOA Antibody
CSB-PA042169-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RHOA Antibody
1-CSB-PA244505
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

RhoA antibody
70R-36009 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody

RHOA antibody
70R-5840 50 ug
EUR 467
Description: Rabbit polyclonal RHOA antibody raised against the middle region of RHOA

RhoA Antibody
AF6352 200ul
EUR 304
Description: RhoA Antibody detects endogenous levels of total RhoA.

RHOA Antibody
1-CSB-PA019682GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RHOA Antibody
1-CSB-PA00875A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHOA siRNA
20-abx904569
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHOA siRNA
20-abx931462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHOA siRNA
20-abx931463
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RhoA Antibody
AF7830 200ul
EUR 376
Description: RhoA Antibody detects endogenous levels of RhoA.

RhoA Antibody
ABF6352 100 ug
EUR 438

RhoA Antibody
ABD6075 100 ug
EUR 438

pOTB7-RHOA
PVT18653 2 ug
EUR 231

anti-RhoA
YF-PA10313 100 ug
EUR 403
Description: Rabbit polyclonal to RhoA

anti-RhoA
YF-PA23244 50 ul
EUR 334
Description: Mouse polyclonal to RhoA

Bovine RHOA/ Transforming protein RhoA ELISA Kit
E0237Bo 1 Kit
EUR 717

Human RHOA(Transforming protein RhoA) ELISA Kit
EH2484 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P61586
  • Alias: RHOA/Rho cDNA clone 12/h12//ARH12/ARHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human RHOA/ Transforming protein RhoA ELISA Kit
E2150Hu 1 Kit
EUR 605

Mouse Transforming protein RhoA, Rhoa ELISA KIT
ELI-14416m 96 Tests
EUR 865

Human Transforming protein RhoA, RHOA ELISA KIT
ELI-45211h 96 Tests
EUR 824

Cow Transforming Protein RhoA (RHOA) ELISA Kit
abx521182-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Transforming Protein RhoA (RHOA) ELISA Kit
abx521183-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Transforming Protein RhoA (RHOA) ELISA Kit
abx521185-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Transforming Protein RhoA (RHOA) ELISA Kit
abx521186-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Transforming protein RhoA (RHOA) ELISA Kit
abx571681-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Bovine Transforming protein RhoA, RHOA ELISA KIT
ELI-41098b 96 Tests
EUR 928

ELISA kit for Rat Transforming protein RhoA (RHOA)
KTE100296-48T 48T
EUR 332
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming protein RhoA (RHOA)
KTE100296-5platesof96wells 5 plates of 96 wells
EUR 2115
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming protein RhoA (RHOA)
KTE100296-96T 96T
EUR 539
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)
KTE60797-48T 48T
EUR 332
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)
KTE60797-5platesof96wells 5 plates of 96 wells
EUR 2115
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)
KTE60797-96T 96T
EUR 539
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RHOA Rabbit pAb
A15641-100ul 100 ul
EUR 308

RHOA Rabbit pAb
A15641-200ul 200 ul
EUR 459

RHOA Rabbit pAb
A15641-20ul 20 ul
EUR 183

RHOA Rabbit pAb
A15641-50ul 50 ul
EUR 223

RhoA Rabbit pAb
A13947-100ul 100 ul
EUR 308

RhoA Rabbit pAb
A13947-200ul 200 ul
EUR 459

RhoA Rabbit pAb
A13947-20ul 20 ul
EUR 183

RhoA Rabbit pAb
A13947-50ul 50 ul
EUR 223

RHOA Blocking Peptide
33R-3522 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOA antibody, catalog no. 70R-5840

RhoA antibody (biotin)
60R-1308 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody (biotin)

RhoA antibody (FITC)
60R-1309 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody (FITC)

RhoA antibody (HRP)
60R-1310 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody (HRP)

RhoA Blocking Peptide
DF6075-BP 1mg
EUR 195

RhoA Rabbit pAb
A0272-100ul 100 ul
EUR 308

RhoA Rabbit pAb
A0272-200ul 200 ul
EUR 459

RhoA Rabbit pAb
A0272-20ul 20 ul
EUR 183

RhoA Rabbit pAb
A0272-50ul 50 ul
EUR 223

RhoA (pS188) Antibody
abx218288-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RhoA Blocking Peptide
20-abx162020
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RhoA (pS188) Antibody
abx011471-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RhoA Conjugated Antibody
C49020 100ul
EUR 397

RhoA Blocking Peptide
AF6352-BP 1mg
EUR 195

RhoA Conjugated Antibody
C21585 100ul
EUR 397

RHOA Conjugated Antibody
C31150 100ul
EUR 397

RHOA cloning plasmid
CSB-CL019682HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 582
  • Sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagagttggctttgtggga
  • Show more
Description: A cloning plasmid for the RHOA gene.

RHOA cloning plasmid
CSB-CL019682HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 582
  • Sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagaattggctttgtggga
  • Show more
Description: A cloning plasmid for the RHOA gene.

RhoA Blocking Peptide
AF7830-BP 1mg
EUR 195

RHOA Polyclonal Antibody
A53873 100 µg
EUR 570.55
Description: reagents widely cited

anti- RHOA antibody
FNab07281 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ras homolog gene family, member A
  • Uniprot ID: P61586
  • Gene ID: 387
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against RHOA

Anti-RHOA antibody
PAab07281 100 ug
EUR 386

Copyright © 2021 Beopenlab - WordPress Theme : by Sparkle Themes