Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit

EUR 673
  • Should the Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ras Homolog Gene Family, Member A (RHOA) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit

RD-RHOA-Hu-48Tests 48 Tests
EUR 521

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit

RD-RHOA-Hu-96Tests 96 Tests
EUR 723

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit

RDR-RHOA-Hu-48Tests 48 Tests
EUR 544

Human Ras Homolog Gene Family, Member A (RHOA) ELISA Kit

RDR-RHOA-Hu-96Tests 96 Tests
EUR 756

Rhoa/ Rat Rhoa ELISA Kit

ELI-14417r 96 Tests
EUR 886

Human Transforming protein RhoA (RHOA)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transforming protein RhoA(RHOA),partial expressed in E.coli

RhoA Antibody

AF6352 200ul
EUR 304
Description: RhoA Antibody detects endogenous levels of total RhoA.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RhoA Antibody

AF7830 200ul
EUR 376
Description: RhoA Antibody detects endogenous levels of RhoA.

RhoA Antibody

ABF6352 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHOA antibody

70R-5840 50 ug
EUR 467
Description: Rabbit polyclonal RHOA antibody raised against the middle region of RHOA

RhoA antibody

70R-36009 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody

RhoA Antibody

ABD6075 100 ug
EUR 438

RhoA antibody

38121-100ul 100ul
EUR 252

RhoA Antibody

49020-100ul 100ul
EUR 333

RhoA Antibody

49020-50ul 50ul
EUR 239

RHOA Antibody

31150-100ul 100ul
EUR 252

RHOA Antibody

31150-50ul 50ul
EUR 187

RhoA Antibody

21585-100ul 100ul
EUR 252

RhoA Antibody

21585-50ul 50ul
EUR 187

RHOA Antibody

25545-100ul 100ul
EUR 390

RHOA antibody

70R-19884 50 ul
EUR 435
Description: Rabbit polyclonal RHOA antibody

RhoA antibody

70R-15157 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody

RhoA Antibody

DF6075 200ul
EUR 304
Description: RhoA Antibody detects endogenous levels of total RhoA.

RHOA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

RHOA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RHOA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

RHOA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

RHOA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHOA Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RHOA Antibody

CSB-PA042169-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RHOA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RHOA. Recognizes RHOA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


PVT18653 2 ug
EUR 231


YF-PA10313 100 ug
EUR 403
Description: Rabbit polyclonal to RhoA


YF-PA23244 50 ul
EUR 334
Description: Mouse polyclonal to RhoA

Cow Transforming Protein RhoA (RHOA) ELISA Kit

abx521182-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Transforming Protein RhoA (RHOA) ELISA Kit

abx521183-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Transforming Protein RhoA (RHOA) ELISA Kit

abx521185-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Transforming Protein RhoA (RHOA) ELISA Kit

abx521186-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Transforming protein RhoA (RHOA) ELISA Kit

abx571681-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Bovine RHOA/ Transforming protein RhoA ELISA Kit

E0237Bo 1 Kit
EUR 717

Human RHOA/ Transforming protein RhoA ELISA Kit

E2150Hu 1 Kit
EUR 605

Human RHOA(Transforming protein RhoA) ELISA Kit

EH2484 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P61586
  • Alias: RHOA/Rho cDNA clone 12/h12//ARH12/ARHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Mouse Transforming protein RhoA, Rhoa ELISA KIT

ELI-14416m 96 Tests
EUR 865

Human Transforming protein RhoA, RHOA ELISA KIT

ELI-45211h 96 Tests
EUR 824

Bovine Transforming protein RhoA, RHOA ELISA KIT

ELI-41098b 96 Tests
EUR 928

ELISA kit for Rat Transforming protein RhoA (RHOA)

KTE100296-48T 48T
EUR 332
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming protein RhoA (RHOA)

KTE100296-5platesof96wells 5 plates of 96 wells
EUR 2115
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transforming protein RhoA (RHOA)

KTE100296-96T 96T
EUR 539
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)

KTE60797-48T 48T
EUR 332
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)

KTE60797-5platesof96wells 5 plates of 96 wells
EUR 2115
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transforming protein RhoA (RHOA)

KTE60797-96T 96T
EUR 539
  • RhoA is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 and DIAPH1. RhoA is part of a larger family of related proteins known as the Ras superfamily
  • p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transforming protein RhoA (RHOA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RhoA Blocking Peptide

AF6352-BP 1mg
EUR 195

RhoA Conjugated Antibody

C49020 100ul
EUR 397

RHOA Conjugated Antibody

C31150 100ul
EUR 397

RhoA Conjugated Antibody

C21585 100ul
EUR 397

RhoA Blocking Peptide

AF7830-BP 1mg
EUR 195

RHOA cloning plasmid

CSB-CL019682HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 582
  • Sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagagttggctttgtggga
  • Show more
Description: A cloning plasmid for the RHOA gene.

RHOA cloning plasmid

CSB-CL019682HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 582
  • Sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagaattggctttgtggga
  • Show more
Description: A cloning plasmid for the RHOA gene.

anti- RHOA antibody

FNab07281 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ras homolog gene family, member A
  • Uniprot ID: P61586
  • Gene ID: 387
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against RHOA

RhoA Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RhoA (pS188) Antibody

abx011471-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RhoA (pS188) Antibody

abx218288-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RhoA Rabbit pAb

A0272-100ul 100 ul
EUR 308

RhoA Rabbit pAb

A0272-200ul 200 ul
EUR 459

RhoA Rabbit pAb

A0272-20ul 20 ul
EUR 183

RhoA Rabbit pAb

A0272-50ul 50 ul
EUR 223

RHOA Polyclonal Antibody

A53873 100 µg
EUR 570.55
Description: reagents widely cited

RHOA Rabbit pAb

A15641-100ul 100 ul
EUR 308

RHOA Rabbit pAb

A15641-200ul 200 ul
EUR 459

RHOA Rabbit pAb

A15641-20ul 20 ul
EUR 183

RHOA Rabbit pAb

A15641-50ul 50 ul
EUR 223

RhoA Rabbit pAb

A13947-100ul 100 ul
EUR 308

RhoA Rabbit pAb

A13947-200ul 200 ul
EUR 459

RhoA Rabbit pAb

A13947-20ul 20 ul
EUR 183

RhoA Rabbit pAb

A13947-50ul 50 ul
EUR 223

RHOA Blocking Peptide

33R-3522 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOA antibody, catalog no. 70R-5840

RhoA antibody (biotin)

60R-1308 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody (biotin)

RhoA antibody (FITC)

60R-1309 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody (FITC)

RhoA antibody (HRP)

60R-1310 100 ug
EUR 327
Description: Rabbit polyclonal RhoA antibody (HRP)

RhoA Blocking Peptide

DF6075-BP 1mg
EUR 195

Anti-RHOA antibody

PAab07281 100 ug
EUR 386