  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB22A antibody

70R-4379 50 ug
EUR 467
Description: Rabbit polyclonal RAB22A antibody raised against the middle region of RAB22A

RAB22A Antibody

36733-100ul 100ul
EUR 252

RAB22A antibody

70R-19692 50 ul
EUR 435
Description: Rabbit polyclonal RAB22A antibody

RAB22A Antibody

DF9820 200ul
EUR 304
Description: RAB22A Antibody detects endogenous levels of total RAB22A.

RAB22A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB22A. Recognizes RAB22A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB22A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB22A. Recognizes RAB22A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

RAB22A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB22A. Recognizes RAB22A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


YF-PA20176 50 ul
EUR 363
Description: Mouse polyclonal to RAB22A


YF-PA20177 50 ug
EUR 363
Description: Mouse polyclonal to RAB22A


YF-PA20178 100 ul
EUR 403
Description: Rabbit polyclonal to RAB22A

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Rab22A, Member Ras Oncogene Family (RAB22A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody

abx030618-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody

abx030618-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody

abx237004-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB22A, Member RAS Oncogene Family (RAB22A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB22A Conjugated Antibody

C36733 100ul
EUR 397

anti- RAB22A antibody

FNab07004 100µg
EUR 548.75
  • Immunogen: RAB22A, member RAS oncogene family
  • Uniprot ID: Q9UL26
  • Gene ID: 57403
  • Research Area: Signal Transduction
Description: Antibody raised against RAB22A

RAB22A-specific Antibody

abx237005-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RAB22A Rabbit pAb

A3685-100ul 100 ul
EUR 308

RAB22A Rabbit pAb

A3685-200ul 200 ul
EUR 459

RAB22A Rabbit pAb

A3685-20ul 20 ul Ask for price

RAB22A Rabbit pAb

A3685-50ul 50 ul Ask for price

RAB22A Rabbit pAb

A15485-100ul 100 ul
EUR 308

RAB22A Rabbit pAb

A15485-200ul 200 ul
EUR 459

RAB22A Rabbit pAb

A15485-20ul 20 ul
EUR 183

RAB22A Rabbit pAb

A15485-50ul 50 ul
EUR 223

RAB22A Blocking Peptide

33R-3964 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB22A antibody, catalog no. 70R-4379

RAB22A Blocking Peptide

DF9820-BP 1mg
EUR 195

RAB22A cloning plasmid

CSB-CL891957HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 585
  • Sequence: atggcgctgagggagctcaaagtgtgtctgctcggggatacaggtgtaggtaaatcgagtattgtgtggcggtttgtggaagacagttttgatccaaacatcaacccaacaataggggcatcttttatgaccaagactgtccagtaccaaaatgagctacataaattcctaatctg
  • Show more
Description: A cloning plasmid for the RAB22A gene.

Anti-RAB22A antibody

PAab07004 100 ug
EUR 386

Anti-RAB22A antibody

STJ26446 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments.

Anti-RAB22A antibody

STJ117680 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments.

Anti-RAB22A (2B12)

YF-MA19047 100 ug
EUR 363
Description: Mouse monoclonal to RAB22A


ELI-18282d 96 Tests
EUR 928


EF002223 96 Tests
EUR 689

anti- RAB22A-specific antibody

FNab07005 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: RAB22A, member RAS oncogene family
  • Uniprot ID: Q9UL26
  • Research Area: Signal Transduction
Description: Antibody raised against RAB22A-specific

RAB22A protein (His tag)

80R-1966 10 ug
EUR 322
Description: Recombinant human RAB22A protein (His tag)

Mouse RAB22A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB22A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-RAB22A-specific antibody

PAab07005 100 ug
EUR 412

RAB22A Recombinant Protein (Human)

RP025441 100 ug Ask for price

RAB22A Recombinant Protein (Rat)

RP223274 100 ug Ask for price

RAB22A Recombinant Protein (Mouse)

RP166223 100 ug Ask for price

Polyclonal RAB22A Antibody (C-term)

AMM07440G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB22A (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RAB22A antibody - middle region

AMM07441G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB22A - middle region. This antibody is tested and proven to work in the following applications:

RAB22A ORF Vector (Human) (pORF)

ORF008481 1.0 ug DNA
EUR 95

Rab22a ORF Vector (Rat) (pORF)

ORF074426 1.0 ug DNA
EUR 506

Rab22a ORF Vector (Mouse) (pORF)

ORF055409 1.0 ug DNA
EUR 506

RAB22A sgRNA CRISPR Lentivector set (Human)

K1772501 3 x 1.0 ug
EUR 339

Rab22a sgRNA CRISPR Lentivector set (Mouse)

K4520101 3 x 1.0 ug
EUR 339

Rab22a sgRNA CRISPR Lentivector set (Rat)

K6601501 3 x 1.0 ug
EUR 339

RAB22A sgRNA CRISPR Lentivector (Human) (Target 1)

K1772502 1.0 ug DNA
EUR 154

RAB22A sgRNA CRISPR Lentivector (Human) (Target 2)

K1772503 1.0 ug DNA
EUR 154

RAB22A sgRNA CRISPR Lentivector (Human) (Target 3)

K1772504 1.0 ug DNA
EUR 154

Rab22a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4520102 1.0 ug DNA
EUR 154

Rab22a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4520103 1.0 ug DNA
EUR 154

Rab22a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4520104 1.0 ug DNA
EUR 154

Rab22a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6601502 1.0 ug DNA
EUR 154

Rab22a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6601503 1.0 ug DNA
EUR 154

Rab22a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6601504 1.0 ug DNA
EUR 154

Recombinant Human RAB22A Protein, His, E.coli-1ug

QP13233-1ug 1ug
EUR 155

Recombinant Human RAB22A Protein, His, E.coli-50ug

QP13233-50ug 50ug
EUR 1261

Recombinant Human RAB22A Protein, His, E.coli-5ug

QP13233-5ug 5ug
EUR 201

RAB22A Protein Vector (Human) (pPB-C-His)

PV033921 500 ng
EUR 329

RAB22A Protein Vector (Human) (pPB-N-His)

PV033922 500 ng
EUR 329

RAB22A Protein Vector (Human) (pPM-C-HA)

PV033923 500 ng
EUR 329

RAB22A Protein Vector (Human) (pPM-C-His)

PV033924 500 ng
EUR 329

RAB22A Protein Vector (Rat) (pPB-C-His)

PV297702 500 ng
EUR 603

RAB22A Protein Vector (Rat) (pPB-N-His)

PV297703 500 ng
EUR 603

RAB22A Protein Vector (Rat) (pPM-C-HA)

PV297704 500 ng
EUR 603

RAB22A Protein Vector (Rat) (pPM-C-His)

PV297705 500 ng
EUR 603

RAB22A Protein Vector (Mouse) (pPB-C-His)

PV221634 500 ng
EUR 603

RAB22A Protein Vector (Mouse) (pPB-N-His)

PV221635 500 ng
EUR 603

RAB22A Protein Vector (Mouse) (pPM-C-HA)

PV221636 500 ng
EUR 603

RAB22A Protein Vector (Mouse) (pPM-C-His)

PV221637 500 ng
EUR 603

Rab22a 3'UTR GFP Stable Cell Line

TU167399 1.0 ml Ask for price

RAB22A 3'UTR Luciferase Stable Cell Line

TU019375 1.0 ml
EUR 4617

Rab22a 3'UTR Luciferase Stable Cell Line

TU117399 1.0 ml Ask for price

RAB22A 3'UTR GFP Stable Cell Line

TU069375 1.0 ml
EUR 4617

Rab22a 3'UTR GFP Stable Cell Line

TU267184 1.0 ml Ask for price

Rab22a 3'UTR Luciferase Stable Cell Line

TU217184 1.0 ml Ask for price