PSMF1 antibody

70R-19611 50 ul
EUR 435
Description: Rabbit polyclonal PSMF1 antibody

PSMF1 antibody

70R-12839 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PSMF1 antibody

PSMF1 Antibody

32905-100ul 100ul
EUR 252

PSMF1 Antibody

42932-100ul 100ul
EUR 252

PSMF1 Antibody

1-CSB-PA852882DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMF1. Recognizes PSMF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

PSMF1 Antibody

1-CSB-PA852882HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMF1. Recognizes PSMF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PSMF1 Antibody

DF7394 200ul
EUR 304
Description: PSMF1 Antibody detects endogenous levels of total PSMF1.

PSMF1 antibody

70R-9692 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PSMF1 antibody

PSMF1 Antibody

1-CSB-PA018920GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMF1. Recognizes PSMF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMF1 siRNA

20-abx904330
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMF1 siRNA

20-abx930210
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMF1 siRNA

20-abx930211
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMF1 Antibody

ABD7394 100 ug
EUR 438

PSMF1 Blocking Peptide

33R-2238 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMF1 antibody, catalog no. 70R-9692

PSMF1 Blocking Peptide

DF7394-BP 1mg
EUR 195

PSMF1 Conjugated Antibody

C42932 100ul
EUR 397

PSMF1 Conjugated Antibody

C32905 100ul
EUR 397

PSMF1 cloning plasmid

CSB-CL852882HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atgcctaagaagcttgggcccaaatctcagagacagcgtggggctgttgcccccctcacccaggtccagcaggcggcctgttcccccacttataaacaggccaagcgcaatgccaggagctatcagggccgccgccgccgccgtcgttgcagccagaataccacttccagggttcc
  • Show more
Description: A cloning plasmid for the PSMF1 gene.

PSMF1 cloning plasmid

CSB-CL852882HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 816
  • Sequence: atggcgggcctggaggtactgttcgcatcggcagcgccggccatcacctgcaggcaggacgcgctcgtctgcttcttgcattgggaagtggtgacacacggttactgcggcttgggtgtcggtgaccagccgggtcccaatgataagaagtcagaactgctgccagctgggtggaa
  • Show more
Description: A cloning plasmid for the PSMF1 gene.

PSMF1 Polyclonal Antibody

A57165 100 µg
EUR 570.55
Description: Ask the seller for details

PSMF1 Rabbit pAb

A5554-100ul 100 ul
EUR 308

PSMF1 Rabbit pAb

A5554-200ul 200 ul
EUR 459

PSMF1 Rabbit pAb

A5554-20ul 20 ul
EUR 183

PSMF1 Rabbit pAb

A5554-50ul 50 ul
EUR 223

anti- PSMF1 antibody

FNab06898 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
  • Uniprot ID: Q92530
  • Gene ID: 9491
  • Research Area: Developmental biology
Description: Antibody raised against PSMF1

Anti-PSMF1 antibody

PAab06898 100 ug
EUR 355

Anti-PSMF1 antibody

STJ27500 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a protein that inhibits the activation of the proteasome by the 11S and 19S regulators. Alternative transcript variants have been identified for this gene.

PSMF1 Antibody, HRP conjugated

1-CSB-PA852882HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMF1. Recognizes PSMF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMF1 Antibody, FITC conjugated

1-CSB-PA852882HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMF1. Recognizes PSMF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMF1 Antibody, Biotin conjugated

1-CSB-PA852882HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMF1. Recognizes PSMF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMF1 protein (His tag)

80R-2094 100 ug
EUR 424
Description: Recombinant human PSMF1 protein (His tag)

PSMF1 ELISA KIT|Human

EF002141 96 Tests
EUR 689

Rat PSMF1 shRNA Plasmid

20-abx991188
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMF1 (Isoform 1) Antibody

abx430113-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human PSMF1 shRNA Plasmid

20-abx956302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMF1 shRNA Plasmid

20-abx981646
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMF1 Recombinant Protein (Human)

RP042574 100 ug Ask for price

PSMF1 Recombinant Protein (Mouse)

RP165374 100 ug Ask for price

PSMF1 Recombinant Protein (Rat)

RP222710 100 ug Ask for price

Polyclonal PSMF1 antibody - middle region

APR01398G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMF1 - middle region. This antibody is tested and proven to work in the following applications:

PSMF1 Polyclonal Antibody, HRP Conjugated

A57166 100 µg
EUR 570.55
Description: The best epigenetics products

PSMF1 Polyclonal Antibody, FITC Conjugated

A57167 100 µg
EUR 570.55
Description: kits suitable for this type of research

PSMF1 Polyclonal Antibody, Biotin Conjugated

A57168 100 µg
EUR 570.55
Description: fast delivery possible

Psmf1 ORF Vector (Rat) (pORF)

ORF074238 1.0 ug DNA
EUR 506

PSMF1 ORF Vector (Human) (pORF)

ORF014192 1.0 ug DNA
EUR 354

Psmf1 ORF Vector (Mouse) (pORF)

ORF055126 1.0 ug DNA
EUR 506

Human Proteasome inhibitor PI31 subunit (PSMF1)

1-CSB-EP852882HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasome inhibitor PI31 subunit(PSMF1) expressed in E.coli

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

20-abx004253
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

20-abx114760
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

abx122058-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

20-abx141769
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

abx236898-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

20-abx321760
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Inhibitor Subunit 1 (PSMF1) Antibody

20-abx301611
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Psmf1 sgRNA CRISPR Lentivector set (Rat)

K7510101 3 x 1.0 ug
EUR 339