PSMB10 antibody

38658-100ul 100ul
EUR 252

PSMB10 antibody

70R-5872 50 ug
EUR 467
Description: Rabbit polyclonal PSMB10 antibody

PSMB10 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB10. Recognizes PSMB10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PSMB10 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMB10. Recognizes PSMB10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB10 Blocking Peptide

33R-2068 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB10 antibody, catalog no. 70R-5872

PSMB10 Conjugated Antibody

C38658 100ul
EUR 397

PSMB10 cloning plasmid

CSB-CL018877HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgctgaagccagccctggagccccgagggggcttctccttcgagaactgccaaagaaatgcatcattggaacgcgtcctcccggggctcaaggtccctcacgcacgcaagaccgggaccaccatcgcgggcctggtgttccaagacggggtcattctgggcgccgatacgcgagc
  • Show more
Description: A cloning plasmid for the PSMB10 gene.

PSMB10 cloning plasmid

CSB-CL018877HU2-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgctgaagccagccctggagccccgagggggcttctccttcgagaactgccaaagaaatgcatcattggaacgcgtcctcccggggctcaaggtccctcacgcacgcaagaccgggaccaccatcgcgggcctggtgttccaagacggggtcattctgggcgccgatacgcgagc
  • Show more
Description: A cloning plasmid for the PSMB10 gene.

PSMB10 Rabbit pAb

A5452-100ul 100 ul
EUR 308

PSMB10 Rabbit pAb

A5452-200ul 200 ul
EUR 459

PSMB10 Rabbit pAb

A5452-20ul 20 ul
EUR 183

PSMB10 Rabbit pAb

A5452-50ul 50 ul
EUR 223

anti- PSMB10 antibody

FNab06869 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: proteasome (prosome, macropain) subunit, beta type, 10
  • Uniprot ID: P40306
  • Gene ID: 5699
  • Research Area: Metabolism
Description: Antibody raised against PSMB10

anti-PSMB10 (3F8)

LF-MA10253 100 ug
EUR 363
Description: Mouse monoclonal to PSMB10

Anti-PSMB10 antibody

PAab06869 100 ug
EUR 355

Anti-PSMB10 antibody

STJ27405 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Proteolytic processing is required to generate a mature subunit. Expression of this gene is induced by gamma interferon, and this gene product replaces catalytic subunit 2 (proteasome beta 7 subunit) in the immunoproteasome.

PSMB10 protein (His tag)

80R-1968 10 ug
EUR 322
Description: Recombinant human PSMB10 protein (His tag)


EF002110 96 Tests
EUR 689

Polyclonal PSMB10 Antibody (Internal)

APG01213G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMB10 (Internal). This antibody is tested and proven to work in the following applications:

Rat PSMB10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMB10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMB10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMB10 Recombinant Protein (Human)

RP024916 100 ug Ask for price

PSMB10 Recombinant Protein (Human)

RP024919 100 ug Ask for price

PSMB10 Recombinant Protein (Mouse)

RP165263 100 ug Ask for price

PSMB10 Recombinant Protein (Rat)

RP222605 100 ug Ask for price

Polyclonal PSMB10 Antibody (C-term)

APR03711G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB10 (C-term). This antibody is tested and proven to work in the following applications:

Psmb10 ORF Vector (Rat) (pORF)

ORF074203 1.0 ug DNA
EUR 506

PSMB10 ORF Vector (Human) (pORF)

ORF008306 1.0 ug DNA
EUR 95

PSMB10 ORF Vector (Human) (pORF)

ORF008307 1.0 ug DNA
EUR 95

Psmb10 ORF Vector (Mouse) (pORF)

ORF055089 1.0 ug DNA
EUR 506

Psmb10 sgRNA CRISPR Lentivector set (Rat)

K7419801 3 x 1.0 ug
EUR 339

Psmb10 sgRNA CRISPR Lentivector set (Mouse)

K4369701 3 x 1.0 ug
EUR 339

PSMB10 sgRNA CRISPR Lentivector set (Human)

K1740501 3 x 1.0 ug
EUR 339

Human Proteasome subunit beta type-10 (PSMB10)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasome subunit beta type-10(PSMB10) expressed in E.coli

Proteasome Subunit Beta Type 10 (PSMB10) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 10 (PSMB10) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 10 (PSMB10) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 10 (PSMB10) Antibody

abx340226-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 10 (PSMB10) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 10 (PSMB10) Antibody

abx236869-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Monoclonal PSMB10 Antibody (monoclonal) (M01), Clone: 3F8

AMM03949G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PSMB10 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F8. This antibody is applicable in WB and IF, E

Psmb10 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7419802 1.0 ug DNA
EUR 154

Psmb10 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7419803 1.0 ug DNA
EUR 154

Psmb10 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7419804 1.0 ug DNA
EUR 154

Psmb10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4369702 1.0 ug DNA
EUR 154

Psmb10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4369703 1.0 ug DNA
EUR 154

Psmb10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4369704 1.0 ug DNA
EUR 154

PSMB10 sgRNA CRISPR Lentivector (Human) (Target 1)

K1740502 1.0 ug DNA
EUR 154

PSMB10 sgRNA CRISPR Lentivector (Human) (Target 2)

K1740503 1.0 ug DNA
EUR 154

PSMB10 sgRNA CRISPR Lentivector (Human) (Target 3)

K1740504 1.0 ug DNA
EUR 154

PSMB10 Protein Vector (Rat) (pPB-C-His)

PV296810 500 ng
EUR 603