P2RY12 Antibody

ABD10263 100 ug
EUR 438

P2RY12 Antibody

31255-100ul 100ul
EUR 252

P2RY12 Antibody

31255-50ul 50ul
EUR 187

P2RY12 Antibody

DF10263 200ul
EUR 304
Description: P2RY12 Antibody detects endogenous levels of total P2RY12.

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit

DLR-P2RY12-Hu-48T 48T
EUR 517
  • Should the Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit

DLR-P2RY12-Hu-96T 96T
EUR 673
  • Should the Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit

RD-P2RY12-Hu-48Tests 48 Tests
EUR 521

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit

RD-P2RY12-Hu-96Tests 96 Tests
EUR 723

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit

RDR-P2RY12-Hu-48Tests 48 Tests
EUR 544

Human Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) ELISA Kit

RDR-P2RY12-Hu-96Tests 96 Tests
EUR 756

P2ry12/ Rat P2ry12 ELISA Kit

ELI-37646r 96 Tests
EUR 886

P2RY12 Conjugated Antibody

C31255 100ul
EUR 397

Anti-P2RY12 antibody

STJ117783 100 µl
EUR 277
Description: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene.

P2RY12 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY12 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY12 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY12 Rabbit pAb

A1710-100ul 100 ul
EUR 308

P2RY12 Rabbit pAb

A1710-200ul 200 ul
EUR 459

P2RY12 Rabbit pAb

A1710-20ul 20 ul
EUR 183

P2RY12 Rabbit pAb

A1710-50ul 50 ul
EUR 223

P2RY12 Blocking Peptide

33R-9419 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RY12 antibody, catalog no. 70R-7094

P2RY12 cloning plasmid

CSB-CL861997HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1029
  • Sequence: atgcaagccgtcgacaatctcacctctgcgcctgggaacaccagtctgtgcaccagagactacaaaatcacccaggtcctcttcccactgctctacactgtcctgttttttgttggacttatcacaaatggcctggcgatgaggattttctttcaaatccggagtaaatcaaact
  • Show more
Description: A cloning plasmid for the P2RY12 gene.

P2RY12 Blocking Peptide

DF10263-BP 1mg
EUR 195

pcDNA3.1-P2RY12 Plasmid

PVTB00561-2a 2 ug
EUR 356

Purinergic Receptor P2Y12 (P2RY12) Antibody

abx217587-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Mouse P2RY12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat P2RY12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human P2RY12 ELISA Kit

ELA-E12345h 96 Tests
EUR 824


EF004691 96 Tests
EUR 689

Human P2RY12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RY12 Recombinant Protein (Human)

RP022357 100 ug Ask for price

P2RY12 Recombinant Protein (Rat)

RP219074 100 ug Ask for price

P2RY12 Recombinant Protein (Mouse)

RP159788 100 ug Ask for price

Polyclonal P2RY12 / P2Y12 Antibody (Extracellular Domain)

APR12672G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY12 / P2Y12 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal P2RY12 / P2Y12 Antibody (N-Terminus)

APR12673G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY12 / P2Y12 (N-Terminus). This antibody is tested and proven to work in the following applications:

Human P2Y purinoceptor 12 (P2RY12)

  • EUR 1309.00
  • EUR 583.00
  • EUR 839.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 42.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human P2Y purinoceptor 12(P2RY12) expressed in in vitro E.coli expression system

P2RY12 ORF Vector (Human) (pORF)

ORF007453 1.0 ug DNA
EUR 95

P2ry12 ORF Vector (Rat) (pORF)

ORF073026 1.0 ug DNA
EUR 506

P2ry12 ORF Vector (Mouse) (pORF)

ORF053264 1.0 ug DNA
EUR 506

P2RY12 ELISA Kit (Human) (OKAN05743)

OKAN05743 96 Wells
EUR 792
Description: Description of target: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

P2RY12 ELISA Kit (Human) (OKCD08892)

OKCD08892 96 Wells
EUR 975
Description: Description of target: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

P2RY12 ELISA Kit (Mouse) (OKEH05603)

OKEH05603 96 Wells
EUR 779
Description: Description of target: Receptor for ADP and ATP coupled to G-proteins that inhibit the adenylyl cyclase second messenger system. Required for normal platelet aggregation and blood coagulation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

P2RY12 ELISA Kit (Rat) (OKEH06201)

OKEH06201 96 Wells
EUR 779
Description: Description of target: Receptor for ADP and ATP coupled to G-proteins that inhibit the adenylyl cyclase second messenger system. Required for normal platelet aggregation and blood coagulation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

P2RY12 ELISA Kit (Rat) (OKEH06696)

OKEH06696 96 Wells
EUR 779
Description: Description of target: Receptor for ADP and ATP coupled to G-proteins that inhibit the adenylyl cyclase second messenger system. Required for normal platelet aggregation and blood coagulation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL

P2RY12 sgRNA CRISPR Lentivector set (Human)

K1583001 3 x 1.0 ug
EUR 339

P2ry12 sgRNA CRISPR Lentivector set (Mouse)

K3909901 3 x 1.0 ug
EUR 339

P2ry12 sgRNA CRISPR Lentivector set (Rat)

K7066901 3 x 1.0 ug
EUR 339

Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Purinergic Receptor P2Y, G Protein Coupled 12 (P2RY12) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mouse Purinergic Receptor P2Y12 (P2RY12) ELISA Kit

abx515936-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Purinergic Receptor P2Y12 (P2RY12) ELISA Kit

abx515937-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat P2ry12/ P2Y purinoceptor 12 ELISA Kit

E0721Ra 1 Kit
EUR 646

Mouse P2ry12/ P2Y purinoceptor 12 ELISA Kit

E1091Mo 1 Kit
EUR 632

Human P2RY12/ P2Y purinoceptor 12 ELISA Kit

E1851Hu 1 Kit
EUR 605

Human P2RY12(P2Y purinoceptor 12) ELISA Kit

EH1410 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H244
  • Alias: P2RY12/P2Y purinoceptor 12/P2Y12/P2Y12 platelet ADP receptor/ADP-glucose receptor/ADPG-R
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml