NUP155 Antibody

24722-100ul 100ul
EUR 390

NUP155 antibody

70R-2127 50 ug
EUR 467
Description: Rabbit polyclonal NUP155 antibody raised against the middle region of NUP155

NUP155 antibody

70R-3056 50 ug
EUR 467
Description: Rabbit polyclonal NUP155 antibody raised against the N terminal of NUP155

NUP155 Antibody

DF9708 200ul
EUR 304
Description: NUP155 Antibody detects endogenous levels of total NUP155.

NUP155 Antibody

1-CSB-PA016191ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NUP155. Recognizes NUP155 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

NUP155 antibody

70R-9235 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NUP155 antibody

NUP155 siRNA

20-abx903704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP155 siRNA

20-abx926619
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP155 siRNA

20-abx926620
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP155 Antibody

ABD9708 100 ug
EUR 438

NUP155 Polyclonal Antibody

31321-100ul 100ul
EUR 252

NUP155 Polyclonal Antibody

31321-50ul 50ul
EUR 187

NUP155 Blocking Peptide

33R-4155 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP155 antibody, catalog no. 70R-2127

NUP155 Blocking Peptide

33R-1659 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP155 antibody, catalog no. 70R-9235

NUP155 Blocking Peptide

33R-6308 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP155 antibody, catalog no. 70R-3056

NUP155 Blocking Peptide

DF9708-BP 1mg
EUR 195

Polyclonal NUP155 Antibody

APR17647G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP155 . This antibody is tested and proven to work in the following applications:

NUP155 cloning plasmid

CSB-CL016191HU-10ug 10ug
EUR 1780
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4176
  • Sequence: atgccgtcttctttgttgggcgcggcgatgccggcctctacatctgccgcagccctgcaggaagctctggaaaatgctggacggctcatcgaccgtcagttgcaagaggaccgcatgtacccggacctttccgagctgcttatggtgtctgccccaaataatcccaccgtttctg
  • Show more
Description: A cloning plasmid for the NUP155 gene.

NUP155 Rabbit pAb

A7764-100ul 100 ul
EUR 308

NUP155 Rabbit pAb

A7764-200ul 200 ul
EUR 459

NUP155 Rabbit pAb

A7764-20ul 20 ul
EUR 183

NUP155 Rabbit pAb

A7764-50ul 50 ul
EUR 223

Anti-NUP155 antibody

STJ110075 100 µl
EUR 277
Description: Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6.

Human Nuclear pore complex protein Nup155, NUP155 ELISA KIT

ELI-15040h 96 Tests
EUR 824

Mouse Nuclear pore complex protein Nup155, Nup155 ELISA KIT

ELI-44221m 96 Tests
EUR 865

Nucleoporin 155 (NUP155) Antibody

20-abx007057
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 155 (NUP155) Antibody

20-abx142111
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human NUP155 ELISA Kit

EHN0058 96Tests
EUR 521

Bovine NUP155 ELISA Kit

EBN0058 96Tests
EUR 521

Anserine NUP155 ELISA Kit

EAN0058 96Tests
EUR 521

Canine NUP155 ELISA Kit

ECN0058 96Tests
EUR 521

Goat NUP155 ELISA Kit

EGTN0058 96Tests
EUR 521

Rat NUP155 shRNA Plasmid

20-abx987372
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUP155 Polyclonal Conjugated Antibody

C31321 100ul
EUR 397

Nucleoporin 155 (NUP155) Antibody

20-abx321949
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human NUP155 shRNA Plasmid

20-abx956410
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NUP155 shRNA Plasmid

20-abx980338
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine NUP155 ELISA Kit

EPN0058 96Tests
EUR 521

Rat NUP155 ELISA Kit

ERN0058 96Tests
EUR 521

Rabbit NUP155 ELISA Kit

ERTN0058 96Tests
EUR 521

Mouse NUP155 ELISA Kit

EMN0058 96Tests
EUR 521

Recombinant Nucleoporin 155kDa (NUP155)

4-RPB157Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75694
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Nucleoporin 155kDa expressed in: E.coli

Nucleoporin 155 kDa (NUP155) Antibody

20-abx131357
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea Pig NUP155 ELISA Kit

EGN0058 96Tests
EUR 521

Nup155 ORF Vector (Rat) (pORF)

ORF071614 1.0 ug DNA
EUR 2080

NUP155 ORF Vector (Human) (pORF)

ORF007302 1.0 ug DNA
EUR 95

Nup155 ORF Vector (Mouse) (pORF)

ORF051823 1.0 ug DNA
EUR 1572

NUP155 ELISA Kit (Human) (OKEI00217)

OKEI00217 96 Wells
EUR 767
Description: Description of target: Essential component of nuclear pore complex. Could be essessential for embryogenesis. Nucleoporins may be involved both in binding and translocating proteins during nucleocytoplasmic transport.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

NUP155 ELISA Kit (Mouse) (OKEI00493)

OKEI00493 96 Wells
EUR 767
Description: Description of target: Essential component of nuclear pore complex. Could be essessential for embryogenesis. Nucleoporins may be involved both in binding and translocating proteins during nucleocytoplasmic transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

NUP155 ELISA Kit (Rat) (OKEI00798)

OKEI00798 96 Wells
EUR 767
Description: Description of target: Essential component of nuclear pore complex. Could be essessential for embryogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human Nucleoporin 155 kDa (NUP155) Protein

20-abx168258
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nup155 sgRNA CRISPR Lentivector set (Rat)

K7124601 3 x 1.0 ug
EUR 339

Nup155 sgRNA CRISPR Lentivector set (Mouse)

K4585601 3 x 1.0 ug
EUR 339

NUP155 sgRNA CRISPR Lentivector set (Human)

K1469101 3 x 1.0 ug
EUR 339

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human)

4-PAB157Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155)

Human Nucleoporin 155kDa(NUP155)ELISA Kit

QY-E05261 96T
EUR 400

ELISA kit for Human NUP155 (Nucleoporin 155kDa)

E-EL-H1368 1 plate of 96 wells
EUR 534
  • Gentaur's NUP155 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NUP155. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NUP155 (Nucleoporin 155kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse NUP155 (Nucleoporin 155kDa)

E-EL-M0849 1 plate of 96 wells
EUR 534
  • Gentaur's NUP155 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP155. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse NUP155 (Nucleoporin 155kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat NUP155 (Nucleoporin 155kDa)

E-EL-R0679 1 plate of 96 wells
EUR 534
  • Gentaur's NUP155 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat NUP155. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat NUP155 (Nucleoporin 155kDa) in samples from Serum, Plasma, Cell supernatant

Pig Nucleoporin 155 kDa (NUP155) ELISA Kit

abx361056-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Nucleoporin 155 kDa (NUP155) ELISA Kit

abx363223-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Nucleoporin 155 kDa (NUP155) ELISA Kit

abx352910-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Nucleoporin 155 kDa (NUP155) ELISA Kit

abx353806-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Nucleoporin 155 kDa (NUP155) ELISA Kit

abx354441-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Nucleoporin 155 kDa (NUP155) ELISA Kit

abx356689-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Nucleoporin 155 kDa (NUP155) ELISA Kit

abx359130-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Nucleoporin 155 kDa (NUP155) ELISA Kit

abx364030-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Nup155 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7124602 1.0 ug DNA
EUR 154

Nup155 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7124603 1.0 ug DNA
EUR 154

Nup155 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7124604 1.0 ug DNA
EUR 154

Nup155 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4585602 1.0 ug DNA
EUR 154

Nup155 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4585603 1.0 ug DNA
EUR 154

Nup155 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4585604 1.0 ug DNA
EUR 154

NUP155 sgRNA CRISPR Lentivector (Human) (Target 1)

K1469102 1.0 ug DNA
EUR 154

NUP155 sgRNA CRISPR Lentivector (Human) (Target 2)

K1469103 1.0 ug DNA
EUR 154

NUP155 sgRNA CRISPR Lentivector (Human) (Target 3)

K1469104 1.0 ug DNA
EUR 154

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), APC

4-PAB157Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with APC.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), Biotinylated

4-PAB157Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with Biotin.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), Cy3

4-PAB157Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with Cy3.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), FITC

4-PAB157Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with FITC.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), HRP

4-PAB157Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with HRP.

Nucleoporin 155kDa (NUP155) Polyclonal Antibody (Human), PE

4-PAB157Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP155 (Gln1154~Asn1379)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 155kDa (NUP155). This antibody is labeled with PE.

NUP155 Protein Vector (Rat) (pPB-C-His)

PV286454 500 ng
EUR 2370

NUP155 Protein Vector (Rat) (pPB-N-His)

PV286455 500 ng
EUR 2370

NUP155 Protein Vector (Rat) (pPM-C-HA)

PV286456 500 ng
EUR 2370

NUP155 Protein Vector (Rat) (pPM-C-His)

PV286457 500 ng
EUR 2370

NUP155 Protein Vector (Mouse) (pPB-C-His)

PV207290 500 ng
EUR 2372

NUP155 Protein Vector (Mouse) (pPB-N-His)

PV207291 500 ng
EUR 2372

NUP155 Protein Vector (Mouse) (pPM-C-HA)

PV207292 500 ng
EUR 2372

NUP155 Protein Vector (Mouse) (pPM-C-His)

PV207293 500 ng
EUR 2372

NUP155 Protein Vector (Human) (pPB-C-His)

PV029205 500 ng
EUR 329

NUP155 Protein Vector (Human) (pPB-N-His)

PV029206 500 ng
EUR 329

NUP155 Protein Vector (Human) (pPM-C-HA)

PV029207 500 ng
EUR 329

NUP155 Protein Vector (Human) (pPM-C-His)

PV029208 500 ng
EUR 329

Nup155 3'UTR Luciferase Stable Cell Line

TU114432 1.0 ml Ask for price