MTX2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MTX2. Recognizes MTX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

MTX2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MTX2. Recognizes MTX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

MTX2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MTX2. Recognizes MTX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17136 50 ul
EUR 363
Description: Mouse polyclonal to MTX2


YF-PA27481 50 ug
EUR 363
Description: Mouse polyclonal to MTX2

MTX2 Polyclonal Antibody

31386-100ul 100ul
EUR 252

MTX2 Polyclonal Antibody

31386-50ul 50ul
EUR 187

MTX2 cloning plasmid

CSB-CL015213HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 792
  • Sequence: atgtctctagtggcggaagccttcgtctcccagattgcagctgcagaaccttggcctgaaaatgctacattatatcagcaattgaaaggggagcaaattttactttctgacaatgcagcttctcttgcagtgcaggcctttttgcaaatgtgtaacttgcctatcaaagtagtttg
  • Show more
Description: A cloning plasmid for the MTX2 gene.

MTX2 Rabbit pAb

A7958-100ul 100 ul
EUR 308

MTX2 Rabbit pAb

A7958-200ul 200 ul
EUR 459

MTX2 Rabbit pAb

A7958-20ul 20 ul
EUR 183

MTX2 Rabbit pAb

A7958-50ul 50 ul
EUR 223

MTX2 Rabbit pAb

A3210-100ul 100 ul
EUR 308

MTX2 Rabbit pAb

A3210-200ul 200 ul
EUR 459

MTX2 Rabbit pAb

A3210-20ul 20 ul Ask for price

MTX2 Rabbit pAb

A3210-50ul 50 ul Ask for price

anti- MTX2 antibody

FNab05425 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: metaxin 2
  • Uniprot ID: O75431
  • Gene ID: 10651
  • Research Area: Developmental biology
Description: Antibody raised against MTX2

Anti-MTX2 antibody

PAab05425 100 ug
EUR 355

Anti-MTX2 antibody

STJ110265 100 µl
EUR 277
Description: The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7.

Anti-MTX2 antibody

STJ24640 100 µl
EUR 277
Description: The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7.

Human Metaxin-2 (MTX2)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Metaxin-2(MTX2) expressed in E.coli

Metaxin 2 (MTX2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metaxin 2 (MTX2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human MTX2 ELISA Kit

ELA-E11961h 96 Tests
EUR 824


EF004297 96 Tests
EUR 689

Mouse MTX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MTX2 Polyclonal Conjugated Antibody

C31386 100ul
EUR 397

Polyclonal MTX2 Antibody (Center)

APR08574G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MTX2 (Center). This antibody is tested and proven to work in the following applications:

Metaxin 2 (MTX2) Antibody

abx235425-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Metaxin 2 (MTX2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metaxin 2 (MTX2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human MTX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Metaxin 2 (MTX2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

pCMV-SPORT6.1-MTX2 Plasmid

PVT16932 2 ug
EUR 325

MTX2 Recombinant Protein (Human)

RP020380 100 ug Ask for price

MTX2 Recombinant Protein (Mouse)

RP152222 100 ug Ask for price

MTX2 Recombinant Protein (Rat)

RP212762 100 ug Ask for price

Mtx2 ORF Vector (Rat) (pORF)

ORF070922 1.0 ug DNA
EUR 506

MTX2 ORF Vector (Human) (pORF)

ORF006794 1.0 ug DNA
EUR 95

Mtx2 ORF Vector (Mouse) (pORF)

ORF050742 1.0 ug DNA
EUR 506

MTX2 ELISA Kit (Mouse) (OKEH05620)

OKEH05620 96 Wells
EUR 779
Description: Description of target: Involved in transport of proteins into the mitochondrion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

MTX2 ELISA Kit (Pig) (OKEH07788)

OKEH07788 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

MTX2 ELISA Kit (Human) (OKEH02194)

OKEH02194 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

Rat Metaxin 2(MTX2) ELISA kit

E02M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Metaxin 2(MTX2) ELISA kit

E02M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Metaxin 2(MTX2) ELISA kit

E02M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metaxin 2(MTX2) ELISA kit

E01M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metaxin 2(MTX2) ELISA kit

E01M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metaxin 2(MTX2) ELISA kit

E01M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metaxin 2(MTX2) ELISA kit

E04M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metaxin 2(MTX2) ELISA kit

E04M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metaxin 2(MTX2) ELISA kit

E04M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metaxin 2(MTX2) ELISA kit

E03M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metaxin 2(MTX2) ELISA kit

E03M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Metaxin 2(MTX2) ELISA kit

E03M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Metaxin 2 (MTX2) ELISA Kit

abx250637-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Mtx2/ Metaxin-2 ELISA Kit

E0987Mo 1 Kit
EUR 632

Goat Metaxin 2(MTX2) ELISA kit

E06M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Metaxin 2(MTX2) ELISA kit

E06M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Metaxin 2(MTX2) ELISA kit

E06M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Metaxin 2(MTX2) ELISA kit

E08M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Metaxin 2(MTX2) ELISA kit

E08M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Metaxin 2(MTX2) ELISA kit

E08M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Metaxin 2(MTX2) ELISA kit

E07M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Metaxin 2(MTX2) ELISA kit

E07M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Metaxin 2(MTX2) ELISA kit

E07M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Metaxin 2(MTX2) ELISA kit

E09M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Metaxin 2(MTX2) ELISA kit

E09M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Metaxin 2(MTX2) ELISA kit

E09M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MTX2/ Metaxin-2 ELISA Kit

E1662Hu 1 Kit
EUR 605

Human MTX2(Metaxin-2) ELISA Kit

EH1366 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O75431
  • Alias: MTX2(Metaxin-2)/Mitochondrial outer membrane import complex protein 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Metaxin- 2, MTX2 ELISA KIT

ELI-13603h 96 Tests
EUR 824

Porcine Metaxin- 2, MTX2 ELISA KIT

ELI-22957p 96 Tests
EUR 928

Mouse Metaxin- 2, Mtx2 ELISA KIT

ELI-42367m 96 Tests
EUR 865

Mouse Metaxin 2 (MTX2) ELISA Kit

abx515707-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig Metaxin 2 (MTX2) ELISA Kit

abx515708-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mtx2 sgRNA CRISPR Lentivector set (Rat)

K7395901 3 x 1.0 ug
EUR 339

Mtx2 sgRNA CRISPR Lentivector set (Mouse)

K3490601 3 x 1.0 ug
EUR 339

MTX2 sgRNA CRISPR Lentivector set (Human)

K1366301 3 x 1.0 ug
EUR 339

Human Metaxin 2(MTX2)ELISA Kit

QY-E04800 96T
EUR 394

Guinea pig Metaxin 2(MTX2) ELISA kit

E05M0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Metaxin 2(MTX2) ELISA kit

E05M0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Metaxin 2(MTX2) ELISA kit

E05M0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Metaxin 2(MTX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mtx2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7395902 1.0 ug DNA
EUR 154

Mtx2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7395903 1.0 ug DNA
EUR 154

Mtx2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7395904 1.0 ug DNA
EUR 154

ELISA kit for Human Metaxin-2 (MTX2)

KTE61467-48T 48T
EUR 332
  • Metaxin-2 encoded by MTX2 is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally as
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Metaxin-2 (MTX2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Metaxin-2 (MTX2)

KTE61467-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Metaxin-2 encoded by MTX2 is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally as
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Metaxin-2 (MTX2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Metaxin-2 (MTX2)

KTE61467-96T 96T
EUR 539
  • Metaxin-2 encoded by MTX2 is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally as
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Metaxin-2 (MTX2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mtx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3490602 1.0 ug DNA
EUR 154

Mtx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3490603 1.0 ug DNA
EUR 154

Mtx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3490604 1.0 ug DNA
EUR 154

MTX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1366302 1.0 ug DNA
EUR 154