MSRB2 siRNA

20-abx903365
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSRB2 siRNA

20-abx924811
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSRB2 siRNA

20-abx924812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSRB2 antibody

70R-18650 50 ul
EUR 435
Description: Rabbit polyclonal MSRB2 antibody

MSRB2 Antibody

1-CSB-PA896505DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB2. Recognizes MSRB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MSRB2 Antibody

1-CSB-PA896505DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB2. Recognizes MSRB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MSRB2 Antibody

1-CSB-PA015052GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MSRB2. Recognizes MSRB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-MSRB2

YF-PA25814 50 ul
EUR 334
Description: Mouse polyclonal to MSRB2

anti- MSRB2 antibody

FNab05383 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: methionine sulfoxide reductase B2
  • Uniprot ID: Q9Y3D2
  • Gene ID: 22921
  • Research Area: Metabolism
Description: Antibody raised against MSRB2

MSRB2 Rabbit pAb

A8364-100ul 100 ul
EUR 308

MSRB2 Rabbit pAb

A8364-200ul 200 ul
EUR 459

MSRB2 Rabbit pAb

A8364-20ul 20 ul
EUR 183

MSRB2 Rabbit pAb

A8364-50ul 50 ul
EUR 223

Human MSRB2 Antibody

33037-05111 150 ug
EUR 261

MSRB2 Polyclonal Antibody

31524-100ul 100ul
EUR 252

MSRB2 Polyclonal Antibody

31524-50ul 50ul
EUR 187

MSRB2 cloning plasmid

CSB-CL896505HU-10ug 10ug
EUR 264
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: atggcgcggctcctctggttgctccggggcctgaccctcggaactgcgcctcggcgggcggtgcggggccaagcgggcggcggcgggcccggcaccgggccgggactgggggaggcagggtctcttgcaacgtgtgagctgcctcttgccaagagtgagtggcaaaagaaactaac
  • Show more
Description: A cloning plasmid for the MSRB2 gene.

Anti-MSRB2 antibody

PAab05383 100 ug
EUR 386

Anti-MSRB2 antibody

STJ110662 100 µl
EUR 277

Anti-MSRB2 (2B7)

YF-MA17761 100 ug
EUR 363
Description: Mouse monoclonal to MSRB2

Anti-MSRB2 (3F12)

YF-MA17762 100 ug
EUR 363
Description: Mouse monoclonal to MSRB2

MSRB2 Polyclonal Conjugated Antibody

C31524 100ul
EUR 397

Mouse MSRB2 shRNA Plasmid

20-abx978616
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MSRB2 shRNA Plasmid

20-abx990174
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MSRB2 ELISA Kit

ELA-E14935h 96 Tests
EUR 824

Mouse Msrb2 ELISA KIT

ELI-04916m 96 Tests
EUR 865

Human MSRB2 ELISA KIT

ELI-04918h 96 Tests
EUR 824

MSRB2 ELISA KIT|Human

EF005824 96 Tests
EUR 689

Human MSRB2 shRNA Plasmid

20-abx957874
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSRB2 protein (His tag)

80R-1574 100 ug
EUR 305
Description: Purified recombinant Human MSRB2 protein

MSRB2 Recombinant Protein (Human)

RP041440 100 ug Ask for price

MSRB2 Recombinant Protein (Rat)

RP212579 100 ug Ask for price

MSRB2 Recombinant Protein (Mouse)

RP151865 100 ug Ask for price

Human MSRB2 AssayMax ELISA Kit

EM2328-1 96 Well Plate
EUR 477

Human MSRB2 Antibody (Biotin Conjugate)

33037-05121 150 ug
EUR 369

Msrb2 ORF Vector (Mouse) (pORF)

ORF050623 1.0 ug DNA
EUR 506

MSRB2 ORF Vector (Human) (pORF)

ORF013814 1.0 ug DNA
EUR 354

Msrb2 ORF Vector (Rat) (pORF)

ORF070861 1.0 ug DNA
EUR 506

MSRB2 ELISA Kit (Human) (OKEH02390)

OKEH02390 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.075 ng/mL

MSRB2 ELISA Kit (Mouse) (OKEH05461)

OKEH05461 96 Wells
EUR 779
Description: Description of target: Methionine-sulfoxide reductase that specifically reduces methionine (R)-sulfoxide back to methionine. While in many cases, methionine oxidation is the result of random oxidation following oxidative stress, methionine oxidation is also a post-translational modification that takes place on specific residue. Upon oxidative stress, may play a role in the preservation of mitochondrial integrity by decreasing the intracellular reactive oxygen species build-up through its scavenging role, hence contributing to cell survival and protein maintenance.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.31 pg/mL

Human MSRB2 AssayLite Antibody (FITC Conjugate)

33037-05141 150 ug
EUR 428

Human MSRB2 AssayLite Antibody (RPE Conjugate)

33037-05151 150 ug
EUR 428

Human MSRB2 AssayLite Antibody (APC Conjugate)

33037-05161 150 ug
EUR 428

Human MSRB2 AssayLite Antibody (PerCP Conjugate)

33037-05171 150 ug
EUR 471

Msrb2 sgRNA CRISPR Lentivector set (Mouse)

K4700201 3 x 1.0 ug
EUR 339

MSRB2 sgRNA CRISPR Lentivector set (Human)

K1350601 3 x 1.0 ug
EUR 339

Msrb2 sgRNA CRISPR Lentivector set (Rat)

K7211201 3 x 1.0 ug
EUR 339

Monoclonal MSRB2 Antibody (monoclonal) (M01), Clone: 2B7

APR08541G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MSRB2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B7. This antibody is applicable in WB, E

Msrb2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4700202 1.0 ug DNA
EUR 154

Msrb2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4700203 1.0 ug DNA
EUR 154

Msrb2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4700204 1.0 ug DNA
EUR 154

MSRB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1350602 1.0 ug DNA
EUR 154

MSRB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1350603 1.0 ug DNA
EUR 154

MSRB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1350604 1.0 ug DNA
EUR 154

Msrb2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7211202 1.0 ug DNA
EUR 154

Msrb2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7211203 1.0 ug DNA
EUR 154

Msrb2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7211204 1.0 ug DNA
EUR 154

MSRB2 Protein Vector (Human) (pPB-C-His)

PV055253 500 ng
EUR 481

MSRB2 Protein Vector (Human) (pPB-N-His)

PV055254 500 ng
EUR 481

MSRB2 Protein Vector (Human) (pPM-C-HA)

PV055255 500 ng
EUR 481

MSRB2 Protein Vector (Human) (pPM-C-His)

PV055256 500 ng
EUR 481

Recombinant Human MSRB2 Protein, His, E.coli-1mg

QP12744-1mg 1mg
EUR 2757

Recombinant Human MSRB2 Protein, His, E.coli-25ug

QP12744-25ug 25ug
EUR 201

Recombinant Human MSRB2 Protein, His, E.coli-5ug

QP12744-5ug 5ug
EUR 155

MSRB2 Protein Vector (Rat) (pPB-C-His)

PV283442 500 ng
EUR 603

MSRB2 Protein Vector (Rat) (pPB-N-His)

PV283443 500 ng
EUR 603

MSRB2 Protein Vector (Rat) (pPM-C-HA)

PV283444 500 ng
EUR 603

MSRB2 Protein Vector (Rat) (pPM-C-His)

PV283445 500 ng
EUR 603

MSRB2 Protein Vector (Mouse) (pPB-C-His)

PV202490 500 ng
EUR 603

MSRB2 Protein Vector (Mouse) (pPB-N-His)

PV202491 500 ng
EUR 603

MSRB2 Protein Vector (Mouse) (pPM-C-HA)

PV202492 500 ng
EUR 603

MSRB2 Protein Vector (Mouse) (pPM-C-His)

PV202493 500 ng
EUR 603

Msrb2 3'UTR GFP Stable Cell Line

TU163532 1.0 ml Ask for price

Msrb2 3'UTR Luciferase Stable Cell Line

TU213493 1.0 ml Ask for price

MSRB2 3'UTR Luciferase Stable Cell Line

TU014778 1.0 ml
EUR 1394

Msrb2 3'UTR Luciferase Stable Cell Line

TU113532 1.0 ml Ask for price

MSRB2 3'UTR GFP Stable Cell Line

TU064778 1.0 ml
EUR 1394

Msrb2 3'UTR GFP Stable Cell Line

TU263493 1.0 ml Ask for price

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody

20-abx113704
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MsrB2) Antibody

20-abx142067
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody

20-abx006135
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody

20-abx322398
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody

20-abx322399
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody

abx235383-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MSRB2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV684445 1.0 ug DNA
EUR 514

MSRB2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV684449 1.0 ug DNA
EUR 514

MSRB2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV684450 1.0 ug DNA
EUR 514

MSRB2 Methionine Sulfoxide Reductase B2 Human Recombinant Protein

PROTQ9Y3D2 Regular: 25ug
EUR 317
Description: MSRB2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 183 amino acids (21-182a.a.) and having a molecular mass of 19.5kDa.;MSRB2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Methionine-R-sulfoxide reductase B2, mitochondrial (MSRB2) ELISA Kit

abx517225-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Methionine-R-sulfoxide reductase B2, mitochondrial (MSRB2) ELISA Kit

abx517226-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Msrb2/ Methionine-R-sulfoxide reductase B2, mitochondrial ELISA Kit

E0638Ra 1 Kit
EUR 646

Mouse Msrb2/ Methionine-R-sulfoxide reductase B2, mitochondrial ELISA Kit

E0974Mo 1 Kit
EUR 632

Human MSRB2/ Methionine-R-sulfoxide reductase B2, mitochondrial ELISA Kit

E1641Hu 1 Kit
EUR 605

Human MSRB2(Methionine-R-sulfoxide reductase B2, mitochondrial) ELISA Kit

EH1677 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Y3D2
  • Alias: MSRB2/Methionine-R-sulfoxide reductase B2, mitochondrial/MsrB2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Methionine-R-sulfoxide reductase B2, mitochondrial (MSRB2) ELISA Kit

abx250974-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.