Beopenlab

MSRB2 siRNA
20-abx903365	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSRB2 siRNA
20-abx924811	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSRB2 siRNA
20-abx924812	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSRB2 antibody
70R-18650	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MSRB2 antibody

MSRB2 Antibody
1-CSB-PA896505DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB2. Recognizes MSRB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MSRB2 Antibody
1-CSB-PA896505DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB2. Recognizes MSRB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MSRB2 Antibody
1-CSB-PA015052GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MSRB2. Recognizes MSRB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-MSRB2
YF-PA25814	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MSRB2

anti- MSRB2 antibody
FNab05383	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: methionine sulfoxide reductase B2 Uniprot ID: Q9Y3D2 Gene ID: 22921 Research Area: Metabolism
Description: Antibody raised against MSRB2

MSRB2 Rabbit pAb
A8364-100ul	Abclonal	100 ul	EUR 308

MSRB2 Rabbit pAb
A8364-200ul	Abclonal	200 ul	EUR 459

MSRB2 Rabbit pAb
A8364-20ul	Abclonal	20 ul	EUR 183

MSRB2 Rabbit pAb
A8364-50ul	Abclonal	50 ul	EUR 223

Human MSRB2 Antibody
33037-05111	AssayPro	150 ug	EUR 261

MSRB2 Polyclonal Antibody
31524-100ul	SAB	100ul	EUR 252

MSRB2 Polyclonal Antibody
31524-50ul	SAB	50ul	EUR 187

MSRB2 cloning plasmid
CSB-CL896505HU-10ug	Cusabio	10ug	EUR 264
Formulation: 10 μg plasmid + 200μl Glycerol Length: 549 Sequence: atggcgcggctcctctggttgctccggggcctgaccctcggaactgcgcctcggcgggcggtgcggggccaagcgggcggcggcgggcccggcaccgggccgggactgggggaggcagggtctcttgcaacgtgtgagctgcctcttgccaagagtgagtggcaaaagaaactaac Show more
Description: A cloning plasmid for the MSRB2 gene.

Anti-MSRB2 antibody
PAab05383	Lifescience Market	100 ug	EUR 386

Anti-MSRB2 antibody
STJ110662	St John's Laboratory	100 µl	EUR 277

Anti-MSRB2 (2B7)
YF-MA17761	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MSRB2

Anti-MSRB2 (3F12)
YF-MA17762	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MSRB2

MSRB2 Polyclonal Conjugated Antibody
C31524	SAB	100ul	EUR 397

Mouse MSRB2 shRNA Plasmid
20-abx978616	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat MSRB2 shRNA Plasmid
20-abx990174	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MSRB2 ELISA Kit
ELA-E14935h	Lifescience Market	96 Tests	EUR 824

Mouse Msrb2 ELISA KIT
ELI-04916m	Lifescience Market	96 Tests	EUR 865

Human MSRB2 ELISA KIT
ELI-04918h	Lifescience Market	96 Tests	EUR 824

MSRB2 ELISA KIT|Human
EF005824	Lifescience Market	96 Tests	EUR 689

Human MSRB2 shRNA Plasmid
20-abx957874	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MSRB2 protein (His tag)
80R-1574	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human MSRB2 protein

MSRB2 Recombinant Protein (Human)
RP041440	ABM	100 ug	Ask for price

MSRB2 Recombinant Protein (Rat)
RP212579	ABM	100 ug	Ask for price

MSRB2 Recombinant Protein (Mouse)
RP151865	ABM	100 ug	Ask for price

Human MSRB2 AssayMax ELISA Kit
EM2328-1	AssayPro	96 Well Plate	EUR 477

Human MSRB2 Antibody (Biotin Conjugate)
33037-05121	AssayPro	150 ug	EUR 369

Msrb2 ORF Vector (Mouse) (pORF)
ORF050623	ABM	1.0 ug DNA	EUR 506

MSRB2 ORF Vector (Human) (pORF)
ORF013814	ABM	1.0 ug DNA	EUR 354

Msrb2 ORF Vector (Rat) (pORF)
ORF070861	ABM	1.0 ug DNA	EUR 506

MSRB2 ELISA Kit (Human) (OKEH02390)
OKEH02390	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.075 ng/mL

MSRB2 ELISA Kit (Mouse) (OKEH05461)
OKEH05461	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Methionine-sulfoxide reductase that specifically reduces methionine (R)-sulfoxide back to methionine. While in many cases, methionine oxidation is the result of random oxidation following oxidative stress, methionine oxidation is also a post-translational modification that takes place on specific residue. Upon oxidative stress, may play a role in the preservation of mitochondrial integrity by decreasing the intracellular reactive oxygen species build-up through its scavenging role, hence contributing to cell survival and protein maintenance.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.31 pg/mL

Human MSRB2 AssayLite Antibody (FITC Conjugate)
33037-05141	AssayPro	150 ug	EUR 428

Human MSRB2 AssayLite Antibody (RPE Conjugate)
33037-05151	AssayPro	150 ug	EUR 428

Human MSRB2 AssayLite Antibody (APC Conjugate)
33037-05161	AssayPro	150 ug	EUR 428

Human MSRB2 AssayLite Antibody (PerCP Conjugate)
33037-05171	AssayPro	150 ug	EUR 471

Msrb2 sgRNA CRISPR Lentivector set (Mouse)
K4700201	ABM	3 x 1.0 ug	EUR 339

MSRB2 sgRNA CRISPR Lentivector set (Human)
K1350601	ABM	3 x 1.0 ug	EUR 339

Msrb2 sgRNA CRISPR Lentivector set (Rat)
K7211201	ABM	3 x 1.0 ug	EUR 339

Monoclonal MSRB2 Antibody (monoclonal) (M01), Clone: 2B7
APR08541G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MSRB2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B7. This antibody is applicable in WB, E

Msrb2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4700202	ABM	1.0 ug DNA	EUR 154

Msrb2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4700203	ABM	1.0 ug DNA	EUR 154

Msrb2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4700204	ABM	1.0 ug DNA	EUR 154

MSRB2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1350602	ABM	1.0 ug DNA	EUR 154

MSRB2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1350603	ABM	1.0 ug DNA	EUR 154

MSRB2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1350604	ABM	1.0 ug DNA	EUR 154

Msrb2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7211202	ABM	1.0 ug DNA	EUR 154

Msrb2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7211203	ABM	1.0 ug DNA	EUR 154

Msrb2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7211204	ABM	1.0 ug DNA	EUR 154

MSRB2 Protein Vector (Human) (pPB-C-His)
PV055253	ABM	500 ng	EUR 481

MSRB2 Protein Vector (Human) (pPB-N-His)
PV055254	ABM	500 ng	EUR 481

MSRB2 Protein Vector (Human) (pPM-C-HA)
PV055255	ABM	500 ng	EUR 481

MSRB2 Protein Vector (Human) (pPM-C-His)
PV055256	ABM	500 ng	EUR 481

Recombinant Human MSRB2 Protein, His, E.coli-1mg
QP12744-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human MSRB2 Protein, His, E.coli-25ug
QP12744-25ug	EnQuireBio	25ug	EUR 201

Recombinant Human MSRB2 Protein, His, E.coli-5ug
QP12744-5ug	EnQuireBio	5ug	EUR 155

MSRB2 Protein Vector (Rat) (pPB-C-His)
PV283442	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Rat) (pPB-N-His)
PV283443	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Rat) (pPM-C-HA)
PV283444	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Rat) (pPM-C-His)
PV283445	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Mouse) (pPB-C-His)
PV202490	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Mouse) (pPB-N-His)
PV202491	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Mouse) (pPM-C-HA)
PV202492	ABM	500 ng	EUR 603

MSRB2 Protein Vector (Mouse) (pPM-C-His)
PV202493	ABM	500 ng	EUR 603

Msrb2 3'UTR GFP Stable Cell Line
TU163532	ABM	1.0 ml	Ask for price

Msrb2 3'UTR Luciferase Stable Cell Line
TU213493	ABM	1.0 ml	Ask for price

MSRB2 3'UTR Luciferase Stable Cell Line
TU014778	ABM	1.0 ml	EUR 1394

Msrb2 3'UTR Luciferase Stable Cell Line
TU113532	ABM	1.0 ml	Ask for price

MSRB2 3'UTR GFP Stable Cell Line
TU064778	ABM	1.0 ml	EUR 1394

Msrb2 3'UTR GFP Stable Cell Line
TU263493	ABM	1.0 ml	Ask for price

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody
20-abx113704	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MsrB2) Antibody
20-abx142067	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody
20-abx006135	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody
20-abx322398	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody
20-abx322399	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B2, Mitochondrial (MSRB2) Antibody
abx235383-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

MSRB2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV684445	ABM	1.0 ug DNA	EUR 514

MSRB2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV684449	ABM	1.0 ug DNA	EUR 514

MSRB2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV684450	ABM	1.0 ug DNA	EUR 514

MSRB2 Methionine Sulfoxide Reductase B2 Human Recombinant Protein
PROTQ9Y3D2	BosterBio	Regular: 25ug	EUR 317
Description: MSRB2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 183 amino acids (21-182a.a.) and having a molecular mass of 19.5kDa.;MSRB2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Methionine-R-sulfoxide reductase B2, mitochondrial (MSRB2) ELISA Kit
abx517225-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Methionine-R-sulfoxide reductase B2, mitochondrial (MSRB2) ELISA Kit
abx517226-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Msrb2/ Methionine-R-sulfoxide reductase B2, mitochondrial ELISA Kit
E0638Ra	Sunlong	1 Kit	EUR 646

Mouse Msrb2/ Methionine-R-sulfoxide reductase B2, mitochondrial ELISA Kit
E0974Mo	Sunlong	1 Kit	EUR 632

Human MSRB2/ Methionine-R-sulfoxide reductase B2, mitochondrial ELISA Kit
E1641Hu	Sunlong	1 Kit	EUR 605

Human MSRB2(Methionine-R-sulfoxide reductase B2, mitochondrial) ELISA Kit
EH1677	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9Y3D2 Alias: MSRB2/Methionine-R-sulfoxide reductase B2, mitochondrial/MsrB2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Methionine-R-sulfoxide reductase B2, mitochondrial (MSRB2) ELISA Kit
abx250974-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.